Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4339
Length(NT) : 465
Best Gene Model Blast : Link to GSTUMT00007732001 E-value : 2e-58
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4339
ACAGTCCTTTTAGCGTATTCATTATCAGCAAGCGCGCTTCCCATATAGAG
CGCGTTCGCTGTTCTCGCAATCATGGGTAGGCACCGAAATTTCTCCTTGG
TTTCCGCTTCGATCCGATGCGCACTACGGATATTAGTGCATGGCTTTTCA
CAATGGTCATTATTTGGCTGACCGTCTTTTGCAGCGCCGCCAAAATCGAA
AGGCCAGAAGATGGCTCTGGGAGATTTCCTTCAAGATGAGAGTACGTCGC
CAGGCACATCCTCTTCGCTTTGCAGGACCCTGCTTGGCGGCTCTTTTTTA
TCGATAATCAACATGCTAACGTATCCCCCCCCCCCGATAGGCTTGGGATC
CTGGGCTGATGAAATGGAGGACATGCCCACCATCCAAAACCGCCCCGGAG
CTGTATATGGCAACCGTCGTGATTATGGTGGAAACAGTAGCTTTGGTGGA
GGTAACCCAAGCAGA

Sequences in the Contig:

SY0AAC30YB21FM1 SY0AAC56YA03FM1