Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4338
Length(NT) : 684
Best Gene Model Blast : Link to GSTUMT00000607001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_01366
Accession: ref|XP_001247595.1| Score: 313 E_value: 3e-27
KEGG Definition: phosphotyrosyl phosphatase activator
Accession: afm:AFUA_6G08680 Score: 304 E_value: 2e-26
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Signal transduction mechanisms].
Kog Number: KOG2867 Score: 232 E_value: 2e-20
PFAM Definition: PTPA, Phosphotyrosyl phosphate activator (PTPA) protein. Phosphotyrosyl phosphatase activator (PTPA) proteins stimulate the phosphotyrosyl phosphatase (PTPase) activity of the dimeric form of protein phosphatase 2A (PP2A). PTPase activity in PP2A (in vitro) is relatively low when compared to the better recognised phosphoserine/ threonine protein phosphorylase activity. The specific biological role of PTPA is unknown, Basal expression of PTPA depends on the activity of a ubiquitous transcription factor, Yin Yang 1 (YY1). The tumour suppressor protein p53 can inhibit PTPA expression through an unknown mechanism that negatively controls YY1..
Pfam Number: pfam03095 Score: 214 E_value: 2e-18
Swissprot: Q4WMU5|PTPA1_ASPFU
Gene Ontology:
GO:0003755 = Molecular function: peptidyl-prolyl cis-trans isomerase activity

Sequence:
>Contig4338
TTGGATTCCCGTTCACCCCGCCATAGATCGCCTTCCTGTTCATAGCCCTC
TACCACCCCCTCTATCCATATCTCGCCTGGCGTTTTCCGCTTTCTGGGCT
CCCATCTCTCCACTCTCATAGATACCGCCATCCTTCCATCAACCCCATCG
CGCTCATTTACATAGTCAACTCTCACCATGACTTCCGATTCTGACCTTCA
GCCGATCGACCCCGCTAAACATGTCTTTGCTATCCCGGCCAAAAGAATTC
ACGTCCAAGAGGACGTTCCGCACTTTATCACCTCACCAGCTTACAAACTG
ATAACTAACTTCATCCTTCACCTTAATGCTTCGGCATCTCCATTAAACCC
AGTAACTGGCGAGCTTCGCAACCCGCAGAACTACACACTGACCTCCCCTA
CCATCCATGTATCTCCCGAAGTCGACGGCATCATCCAGCTCATTCACAAA
CTAGAAGCCCTGGTGACCCGAGCTCCACCGGACCCTGGGCCGCGAAGGTT
CGGCAACACCGCCTACCGTCATTGGTACTCTCTTGTCGAGGACGCTCTCG
GGGGTCCCGATGGACTTCTCGACCAACACCTACCCGCATCGGTGCTCTCA
CCAAAGGGGAAAGGTGAAGTCACCGCCAAGCAGGAATTACTCCCGTATCT
TCTCGGTTCGTTCGGGTCTTCCCAACGACTGGAT

Sequences in the Contig:

SY0AAC30YB10FM1 SY0AAC42YG19FM1 SY0AAC53YI07FM1