Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4337
Length(NT) : 622
Best Gene Model Blast : Link to GSTUMT00004366001 E-value : 5e-84
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_14027
Accession: ref|XP_001804226.1| Score: 141 E_value: 2e-07
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: Glyco_hydro_15, Glycosyl hydrolases family 15..
Pfam Number: pfam00723 Score: 111 E_value: 2e-06
Swissprot: Q03045|AMYG_HORRE

Sequence:
>Contig4337
TTGGCACGCCAACTCTATCAACCAGTAGAATAGTCTTCTCGAACTCCATC
CTTTTTTTTTCAGCTCCTCCTCCCTCTCCCCCCTCTTGAGGTCACGCGGG
ACCTGGAACCACGCCACGAACTTTCTAGGGATCCTGATGGTCTTGCTGCA
ACGACTATAGCTCCCTCTGGTTTCCTGCTTCTGGGGTTTTAGTATAAGGC
TCCTGGAATCATCATAGTATCGTTCCCTTCTCCAGAGATACTTACGGTAT
TTCTTCGCAACTGCAGAAATTCACTTGGGCTCCTTTCTTCACTTCAGCTC
CCCTCAGTTCACGATACTGCGTTCTGGAGAACCCCAATACGCAAATAGCC
TTCTTGCTTTCATAACGATGGTTCTCCTTGAATCCATTCTAATCCCTGTT
GCTACCCTGGGTTATTGCTCCGGTTTCGCAGCTGCTTACGTCGTTTCCGG
ACACTCTACCGACGCTCGACAGTTCACCATTTCAAAGGGTGAACCCCTGC
CCTACGTTCATGACTCCACAACATGGTTGACGGCACCCCCTTTACCGGGT
CATGGGCGAGACCTCAGAGAGATGGACCTGCCCTTAGGGCTCTTACTCTC
ATGAACTTTATTAGAGTAGTTA

Sequences in the Contig:

SY0AAC30YA20FM1 SY0AAC35YI22FM1