Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4336
Length(NT) : 890
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4336
TTCTGTGCTTGAGCATTGAATAGAGTGCCGGTAAATTAACCTAAATTTAT
TTCCCAAAGGGCCATGATACTTCGCATCATAGCGATCACATGTTCACAAT
GCGCTTTCAGCACGATTCTCCATTGCTTGGGCTCGATAGGGCACTGGTAG
CGACTACGTTGTCGCAACTCTGCCCTTCCGGTACCCTACCCGAGTACACC
ACGCCCCGACCCAACACCGCACATACTGTACAACAGTATCATACAGTACC
GGTACGGCAGCCCAATTCAATCGCATCACCGAGCTGGCTAACCTGTGCGC
ATAACCTTTCCCCGTCCCCTCCCCACCTTGGCGGGCCCGTGAGACAAAGT
CTCAGCTGGCCAACTCTTGAGCTTCAGTAAATATTTACAGAGGTTCAGCT
GAGTGAGGATGTGGATTGGCAGGTTCTTGCTGTCCCGATATATCATTTCC
CGAAAAAGGGTTCTTGCATGCATGCATGTTTGGTCGTCCGAATAAGTACG
ATACCGGTATCATACCGGTGCTCAAGAATCGTACAAGCAGGGTGCTCCAC
CGTCGGACCTGTGCTGCTGTTATCGCGACAGTTCTCGAGTACCGTTACCC
TACTCGTACATTACAGTATCTTAGCGGATGATTTCTCCGCCTAACGTAAT
CAGACCGAGGTTATTTACATCCTTGATTGGGTTGGTGTCACGGGGTTTTC
CACTTTTTTCACTTTTTCTCCTTCTATTTTAGGACTCGGGGCTGATTGAG
CAAAACACGAAAGGTGGAGAGGAGGACCCCCCTTCCTTTTTTCCCTCCCC
TTGTGGAGACCCGGTACAAGCCGGTAGACTATCATACCCTACGGTACTCG
AGTATGATACTCTACCCTACCTGTATTTGTTTATAGTTAG

Sequences in the Contig:

SY0AAB8YP15FM1 SY0AAC2YP24FM1 SY0AAD51YG21FM1