Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4335
Length(NT) : 2210
Best Gene Model Blast : Link to GSTUMT00006808001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: adenylate cyclase
Accession: emb|CAB77164.1| Score: 1328 E_value: 1e-144
KEGG Definition: hypothetical protein [EC:4.6.1.1]; K01768 adenylate cyclase
Accession: mgr:MGG_09898 Score: 1273 E_value: 1e-138
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0618 Score: 376 E_value: 2e-36
PFAM Definition: Guanylate_cyc, Adenylate and Guanylate cyclase catalytic domain..
Pfam Number: pfam00211 Score: 255 E_value: 2e-22
Swissprot: Q01631|CYAA_NEUCR
Gene Ontology:
GO:0004016 = Molecular function: adenylate cyclase activity

Sequence:
>Contig4335
TTGGACCATCTTATGCCCTGCGTCAATGCTGCGCCTCATATTCACGAGAC
AGAGATCACCGATCAGCAGGAGTTGCTGATTATTGCTAGCAAGGAATTGT
GGGAGTATATTAGTCCGCAGGCTGTTGTCGATCTCGCACGTCAGGAGAGA
GATGATTTGATGCGGGCTGCCCATAAACTGAGGGATATTGCCATTGCATA
TGGTGCGACTAACAAAATTATGGTCATGATACTTAACGTTGGGGATCTGA
AGAAATCCAAAAGTAGGATGCGCACCCAGTCGATTTCGGTGGGCCCTAGG
CAGACATACCCCGATGAAGAAGCATTATTCCCGTCGGTGAAGGCTCAGAA
AAGGAGAGGGAAGAATGAGATTCCGGATGATTTTGCGTTGGCTCGTCTCG
ATGCTGAGGTAAAGGCACCTGAAGGGGACCTGGCTATGGTGTTTACGGAT
ATCAAGAACTCAACCTTGCTATGGGAAACGTACCCGACGGCGATGCGTTC
TGGCATTAAGCTGCATAACAGTATCATGAGGCGGCAATTGAGGATTGTAG
GGGGTTATGAGATTAAGACTGAGGGTGATGCCTTTATGGTTTGCTTTCCA
ACTGCCACCTCGGCGTTGCTTTGGTGCTTTAGTGTTCAGGCAATTTTGCT
GGATGCACCCTGGCCGTCGGAGATCGTTGAGTCAATTCACGGTAGTCCGG
TCCAAGATGCTAACGGTCATCTTATCTACCGGGGTTTGTCGGTACGAATG
GGCATCCATTGGGGCGCTCCTGTGTGTGAACCGGATCCGATTACGCGCCG
CATGGATTATTTCGGACCTATGGTTAACCGTGCTTCTCGCATCACAGGGG
AAGCGGACGGTGGCCAGATAACGGTCAGCTCTGATTTCGTTGCCGAGATC
AAACGGTGTGTCAAGGCCTACCAGGATTCCGAGCTGGTTGGGGGGCTGTC
ACCCGAGGACCCCTTTGGGGACGAGTCACTTGCACAAACCATTGGCAGAG
AGCTTAGGACGCTGAGCAGTCAAGGCTTCGAGGTTAAGGAACTTGGAGAA
CGTAAACTGAAGGGACTCGAGAATCCAGAATTCATCCACCTGATGTATCC
TCAGTCACTTGTGGGCCGTGTAGCCAATTTAGGGCCTCCTAGGGGTGAGG
TTTCAAAGACAACCGTTGATCCTGCCGATATATGGGCTTTATGGGAAATC
TCTCTTAGGTTAGAAGGGCTATGTTCTTCGCTTAATACCGACGGTGTACC
ATTCCTGAAGCCGCGTGGACTTGAAATGACTGCTAGATTGAAACTCGCGG
GAGAGAACGCTACGGACCAGGTTTTGATGCCCTTCTTCGAGCATATCGTC
ACTCGTATCGAGAACTCCATGACAACTCTCTTCCTTCGAAGAGTCCTCGC
ACCGCCGGGCTGTGGCGCGGAAGAAATGGCGTCCCCTTTAATGGAATTGC
TTTCAGCTCTCGAAGCGAGAGCAGGTGTTAATATCAGCGGAAGAGCAATT
GCATCTGCAGCGTATGGTGGAGTCGGTTCCTCGGCATCGTCTTCCTATTC
TGCTTCATAGTGGACCTATCGTGATTAGGAGGGGAAGAAAACGACTTATT
GTCTATTCGGCTACCATTGCATCGTATTTACATGCTTTGTCCTTTTGCTT
TTTTAGTTGATCGATTACTTGCTTACTCGGGTAGTTTCGGCGAAATGGGG
TTGCACTGGTTTCTTTGTTGTTTGTCTTCTCTTTTCCATTAGGTACTTTT
CCTTGAATGCTTTTGCTAGTGCCTCCAGGTGCCTGCTTGCAGCGTGCGTG
TAATTCATTCTCACAAGCATGGGGATTATATTTTTACATTCCGCCTCTTT
CTCTTTTTTGTCTAATTGTTTGCTGGGAGCGAAAACAAAAGTTGGATTTT
TATTTTTTCCATTCGTTTTTTGATTTGGCTTTGCTTTGGCGGGGGATGTG
GTTGGTTGGCTGGATAGGAATTTGATTTTTTTCGGAACAATCGGTTGCTT
GCTTTTTCGGTGCGGTTGTATGTTTATGTGATATCACGTGCTAGGGTAAA
CCGTTGGGTTGGATATGTGTAATGAGGCATGGGATGGAGTGGGAATGGTT
TGATATGGGATGAGTAGGGTCGAAAGGAACGGACTTAAGGTGGGCGAGTT
TCGCTCGGGTGTGTAGCCATCACACATCTGGTTGTATTGTAATGGAATTC
TGATGATACC

Sequences in the Contig:

SY0AAA30YG09FM1 SY0AAA30YG09RM1 SY0AAA61YI13FM1
SY0AAB21YB06FM1 SY0AAB4YC02FM1 SY0AAB4YL24FM1
SY0AAC25YF21RM1 SY0AAC2YO23FM1 SY0AAC48YF05FM1
SY0AAD2YD13FM1 SY0AAD8YJ15FM1