Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4334
Length(NT) : 830
Best Gene Model Blast : Link to GSTUMT00008284001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: nuclear serine protease HtrA2/Nma111, putative
Accession: ref|XP_001268418.1| Score: 1020 E_value: 1e-109
KEGG Definition: predicted signaling-associated protein (contains a PDZ domain)
Accession: aor:AO090103000320 Score: 1008 E_value: 1e-108
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1421 Score: 733 E_value: 2e-78
PFAM Definition: No Hit Found
Swissprot: A1CUK5|NM111_ASPCL

Sequence:
>Contig4334
TTGGAGTCGACACTAGCCTTAGCGGCCAGTGTGGAAGCGGCGTTCTTGCT
GATGCAGGTGGAACTGTTCAGGCGCTGTGGCTTACTTACCTTGGGGAGCG
AACTCATAGTAACAAGGATGTCGAGTACCATCTTGGCTTGGCTACACCTT
CCCTACTCCCGGTCATTCGTCAGTTACAGAATGGCATAATACCCAAGCTA
AGAATGCTTAATGTTGAACTGCACTTGGTGCACATGAGCCAAGTTCGGAT
TATGGGTGTCTCGGAAGAGTGGATCCGCAGAGTTGAGCAGGATAACCCCG
AGCGCCACCAGTTGTTCATGGTCCGAAAGGTCGAATGCGGCCATTCTCAG
ACTCTGGAAGAAGGAGATGTCATCTTGAGTATTAACGGGAAAGTGATGAC
AAGAATAACAGAGCTAGACGTTATGTACGATCATGAGTACCTGGACATGG
TTGTGGTGAGGAACTGCGAAGAGATGATATTGAGAGTGCCCACTGTCCCA
ACCGACGATTTGGAGACCGATCGCGCTGTCATATTCTGTGGTGCTGTTTT
GCATCGCCCTCATCATGCTGTACGCCAACAAATAAGTACCCTGCACTCTG
AGATCTATGTTTCGGCACGGACTCGGGGTTCCCCGGCGTATCAATACCAG
CTTGTGCCGACAAATTTTATTGTCGGTGTCAACGGAGTCAAGATTTCTGA
TCTTGATTCTTTCTTGCACGAGGTCTCGAAGATACCGGATAATACCTATT
TGAGACTGAGAATCATTACCTTTGATAATATTCCATTCGTGATTACTATC
AAGAAGAACGAACATTATTTCCCCACCATG

Sequences in the Contig:

SY0AAB20YL06FM1 SY0AAC2YO21FM1