Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4333
Length(NT) : 645
Best Gene Model Blast : Link to GSTUMT00005166001 E-value : 2e-68
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_02412
Accession: ref|XP_001793018.1| Score: 502 E_value: 3e-49
KEGG Definition: hypothetical protein; K03233 elongation factor EF-1 gamma subunit
Accession: mgr:MGG_06936 Score: 442 E_value: 1e-42
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0867 Score: 204 E_value: 3e-17
PFAM Definition: GST_N, Glutathione S-transferase, N-terminal domain. Function: conjugation of reduced glutathione to a variety of targets. Also included in the alignment, but are not GSTs: * S-crystallins from squid. Similarity to GST previously noted. * Eukaryotic elongation factors 1-gamma. Not known to have GST activity; similarity not previously recognised. * HSP26 family of stress-related proteins. including auxin-regulated proteins in plants and stringent starvation proteins in E. coli. Not known to have GST activity. Similarity not previously recognised. The glutathione molecule binds in a cleft between N and C-terminal domains - the catalytically important residues are proposed to reside in the N-terminal domain..
Pfam Number: pfam02798 Score: 112 E_value: 1e-06
Swissprot: Q00717|STCT_EMENI

Sequence:
>Contig4333
TTGGGGTTTCTCCTTGAAGCAAACTTGTCAACCACACAACCACTGACTGC
ATCTCATTGTTTTCCCCACACATACTGCATATCATTCCAGACAGAATGCC
CTTCGGAAAAATCTATTCCTATCCTGTGAGTTGCCGTCATTCTCTGCCGC
GTTCTTTGTTCTTGAGATCTCTCTTTTTTTTTTTTTTGCTGGATGCATTT
TTTGCGCTGAGTCATTGGCTAATTCGAAGAATGTATATATATGTATATCG
TAGAAAAACCCTCGCACTACGGCGCTTTTGGCTGTTGCTAAGGAGAATGG
ACTCGAAATCGAGATCGTTCACGAGGAGCCTGATAAGGGTGTGAGTGCTG
AGTACCTCAAGCTCAACCCTCTCGGAAAGGTTCCCACTTTCCAGGGCGAT
GATGGATTCGTTCTGTCTGAGTGCATTGCTATTGCCGTTTACCTTACCGC
CCAGAACGAGAAGACCACTCTGTTGGGAAAGACTAAGCAGGACTATGTGT
CAATTCTGAAGTGGATGTCTTTTGCCAATAGTGAACTTCTGCCAAATCTC
GGAGGCTGGTTCCGTCCCTTGACTGGGCGCGCCCAATATAATAAAAAGAA
CGTTGATACTGCTCAGGCTGGTACCCTCAAGGTCGTTGGTGCCCT

Sequences in the Contig:

SY0AAC2YO17FM1 SY0AAC31YE07FM1