Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4332
Length(NT) : 1277
Best Gene Model Blast : Link to GSTUMT00007839001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 708 E_value: 1e-72
KEGG Definition: hypothetical protein
Accession: ani:AN3547.2 Score: 644 E_value: 2e-65
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 410 E_value: 1e-40
PFAM Definition: No Hit Found
Swissprot: P46825|KLC_LOLPE

Sequence:
>Contig4332
TTGGCTAGCTGTGACGCTTCTTGCTGCGAGAAAATATGAAGAAGCTGAGA
TCATGTATCGACAGGCCCTAAGGACTATGGAAAAGGCTCTTGGACCAGAT
CATCCAGATACCCTTGACACTATGAATACGCTCGGCGAAACGCTACTTGA
GCTGGAAAAGTATGACCAAGCGGAGGCTATATGCCAACGCGCATTAGCGG
GCAGAGGCAAATCTCTAGGAGGAGACCATCCAGCTACCCTTACAAGCGCC
GATAACGTTGGTCGGACATTGTACCATCAGAGAAAGTACGAAGAAGCGGA
GTTGATGTTTCGATCTACGCAGGCGGGCAGAAAAAAGGTCCTCGGACTAT
ATCATCCAGATACCATACTGAGTGTTCTTCGCCTAGGTGTGACACTACTT
GATCAGAAAAAGTATGGAGAAGCCGAGATCATGTATCGACATGCCCTTGA
GGTTATGGAGAAAGCCCTGGGGCCCGATCATCCGGAAGTCCTTGACAGCA
TCAATACGTTAGGTGAGACGCTTCTGGATTTGAAAAAGTATAGCGAAGCG
GAAGTTATGTGTCGACGTGCGCTGGTAGGCAGGGAGAAGACGCTTGGACC
AGACCATCGGGATACCCTCATAAGTGTCAATAATCTTGGTTTGGCGCTGC
GTAATCAGGATAAGCACCACGAAGCGGAGATCAGTTATCGACGTGCGGCG
ATGGGTGCCGAGAAGACGCTTGGGCTTGACCACCCAGACACCTTAATGTG
CATATATAATCTGGCTGGGACGTTGCACAAACAGAGAAGGTACGACGAGG
CGGAGGTAATGTATCGGCGTGTGCTGGGAAGACGAGAGGGGGTTTTGGGG
CTGGGTCATCGACACACTATTCGTAGCCTGATTAAGCTAGGCACGGTACT
CTATGAGAATGGAAAGTACAAGGAAGCGGAGATTATGTATCGACTTGCAG
TTACTAGGGCGGAGAGATATGGGGCCGGGCCATCCTTCGACTCGAAAACC
TTTTAATTACCCCTCGACGTTTCTTTATGCTCGGACGACAAGTGCCTTGG
ACGCAGCATATTGGCGAAGATGAAGGCTTTGGGCTTACTCAGGGATCAAA
TCATGTTGCCTGTTATTTCATGCATCTTAATCTTTTAAATTTCTTTTTCC
CCCAGCGTTTCCAGCTGTTATAACGTCTAGTTCTTTTTGGTGGTGGAGAT
GTTGGGTGATCTAACTTTGCGATAGGAGTTAATTTAGCTTTGTAATTTAA
GATCTAGTAATTTATTCCTTCCATGTG

Sequences in the Contig:

SY0AAA31YE08FM1 SY0AAA31YE08RM1 SY0AAC2YO04FM1