Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4331
Length(NT) : 456
Best Gene Model Blast : Link to GSTUMT00011925001 E-value : 2e-45
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4672 Score: 116 E_value: 3e-07
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 113 E_value: 7e-07

Sequence:
>Contig4331
TTGGGTTGGATGGGGGAGATGAGGCGGTTGAAGTGGAGAAGTCACGGAAG
GAAGAAGAGGAGGAGGTTTGGGGGGAGATGGACGAGGTGGGCGGGGGGAG
TAGTGAGGGGGGCGGAGAGGAGGGGGATTTTACTGATGTGCTTGTGAAGG
TTCGCAGGAGGAGGCCGAGGACTGATAAGGAGGGGGGTGGGAGTAAGAAG
CGGAGGCTAGAGGTTTAGGTTGGGGTGTGTGTGTGTGATGTGATAGGGGT
CCTACTGAGGTTTTTGTTTCGTTTGATTTAGGAAAAGTGGGCCGTTATTT
AGCCAACTCTCGAGCCCGGAATCCCACCCTTTTTTTAGCCTTTCCGACGC
TAAGTTGTGGCTGGGCTGTAAATAATGGTGTGACTCATAATGGTGTGACT
CTAGAGCCTAGATTTGGGGTCAAATTTCTCACGAAAATTGTAATAATTTT
GGATGT

Sequences in the Contig:

SY0AAC21YK04RM1 SY0AAC25YK15RM1 SY0AAC2YN23FM1
SY0AAC49YO01FM1