Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4330
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00000381001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4330
TTGGGAGCGCCGGTTAACCCACAACTCATCATTCTTATCGGGGGGGAACG
GTATGGGAGCATTCGGTCCTCCGGTGGCGGCCCCCCAGATGTGCCGAAAT
TGGAATTACCGGGAATGTCGAACTATTGGCTGTCGCCATCAGCACATCTG
TATCGGGTGTGGTAACAACCATAAGGCTGTGCAATGCCAGCAGGCAGGCA
GTACCTCACAAGTGGTAGCCTACACAGGCAGACATCAAGGACGGACGCAC
ACTGCATACTCGAATGATATTGTAGCTTCTGTCGAGACCGATACCTACCC
CTTTACCGACACTGTTAGCACACAGCTGCTCCGACCAAATACATATATTC
ACTACCCACTTTTTGCTGAACACAATACCCCGATGCCAGCAGGCCAATTG
AAACTCGCAGGATGGAGAGCACTCACTGCCAGCTATCCCGATAGAACCCT
AATAACGACTATACTAGGCATATGCCAATTTGGAGCGAGGATTGGCTATG
AAGGTAAACGCGGTCCAATACGGATACACCAAAATCTCAGTACTGCTAAG
GAGTGGCCCGAGATCGTTGCGGGAGATATTGCAGCTGAGCTCAAAAGGAA
CCGCCTAAAATCCTACCCTGCCTATAACTCCCTATC

Sequences in the Contig:

SY0AAC2YN08FM1 SY0AAC31YE11FM1