Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig433
Length(NT) : 702
Best Gene Model Blast : Link to GSTUMT00011310001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_12638
Accession: ref|XP_001549219.1| Score: 528 E_value: 4e-52
KEGG Definition: hypothetical protein
Accession: ncr:NCU02225.1 Score: 513 E_value: 1e-50
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1931 Score: 235 E_value: 1e-20
PFAM Definition: No Hit Found
Swissprot: P48553|TMEM1_HUMAN
Gene Ontology:
GO:0016021 = Cellular component: integral to membrane
GO:0015081 = Molecular function: sodium ion transmembrane transporter activity
GO:0006814 = Biological process: sodium ion transport

Sequence:
>Contig433
TTGGAGATTCGCAGCGATTTCAATTCCGGAAATAACAAAAAGGATAGGGT
TGTTCAGATACGCATCGGCCCTAGTCATCCGGCATTAGCTACTCTGAGTC
CTCCAGTCCTAGTTGGGAACCAAATTGTACCTGCTACGGAAAGCCCTACG
GAAAGTGAGATGGCGTGGTTGGATCTCATTGCCAAGTTAAAGACTCAGAT
ACTGGCTAGTTTTGATGCAAGAGTTAGCCAGTATGAGGAGGATATTAGGG
AGAAAGATAGCCAGCGGAGACTCCCGGGGTGGAACTTTTGCACATTTTTC
GTCCTTAAGGAAGGCCTTGCGAGAGCATTTGAATCTGTCGGGCTGGTTGA
GGATGCTCTGATTCTCTACGATGAGTTAGGTTTTGGATTGGATGCCGTTG
TTCGGGATCAGCGAGATAAAGAGAAAATCGAGGGAGATCCTGAAGGCGTG
GTTGGAGGAAACTTTGTCGGTTGGACAAAAGAGAGCATTAAGTGGATTGA
ACAAGCAAGGAGGCGGCGGAAGGCTCGATTGGAAGGCAGGAAGGGTGAAG
AGCAGGAAGATGTAGATGACGAGACACCCGTGGGCTCCGAAAAGAAGCCT
TATCGAGAGCTGATACTATCGAACGAAATATCCCTATTCGACTTTAAGAC
GTATCTATTTGCGCGGCAATCTACACTGTTACTTCGCCTGGGGAAGGGCA
AT

Sequences in the Contig:

SY0AAA24YA17FM1 SY0AAA24YA17FM2