Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4329
Length(NT) : 637
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: Gon7, Gon7 family. In S. cerevisiae Gon7 is a member of the KEOPS protein complex. A protein complex proposed to be involved in transcription and promoting telomere uncapping and telomere elongation..
Pfam Number: pfam08738 Score: 115 E_value: 7e-07

Sequence:
>Contig4329
TTGGCAACATCTGCAACATCCACGGCTCCCCACGTTCCTATCACGTACAT
CGCATCGCTTACATACTTCCTCCTCCTCCACTGCCTGGAACAGCTCGGCT
CGGGCTGGACAGAGCCCACAATGCCGACCCTAATAGCGACCTATGTATCC
CCCCTCACCCCCGCCGCCCCCCACACAATCATCAAAACACTCCCAGAAAC
ATCCGATAAGTCTGCCGCGCTGGCAGAACTCCGCGGTGCGGTGGTGGGAT
TGCAGAATGAGGTGAATAGATATCTTACCGCGAAGATGGAGGAGGAAAAG
GGTGGGGGTACGGTTGAGGAGGAGAAGTATGGTGAGGATGATGATGAAGG
AGGGGAGGAGGGAGACAACGTCAAGGGCGGGGTAGCGGCGAAGTAGTTGT
GGAGGGGGGGGTTTATAGTTAGGTGTGCTTGAGAAAGGGAAGTTTATTCT
AGGATGGGTATGATTTCTATGCTATGCGCTGTTATGTTACATGTGCGGCA
GTTACAGATATGGTAGGTGGATGCTCATCGCTTCTTCCCTAGCTTTTCAT
GCCAATTCTTCTTTGCGGGGGCCGTGTTTTTTGCAGGGGCTGATGATGTT
GTGGATGATCCTGCAGCGGCTCTAGGTTCTGCATCTC

Sequences in the Contig:

SY0AAC2YM10FM1 SY0AAD4YH04FM1