Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4328
Length(NT) : 1740
Best Gene Model Blast : Link to GSTUMT00010945001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: hypothetical protein SNOG_10036
Accession: ref|XP_001800319.1| Score: 1086 E_value: 1e-116
KEGG Definition: predicted protein
Accession: aor:AO090001000344 Score: 1053 E_value: 1e-112
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q0UDX8|CHS7_PHANO
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>Contig4328
TTGGCTGTCGTCCGCTCCTTTAACTCTCACCGCAAACCATCCTCCTCTTC
CTCCTCCCCCTCCTCCTCCCTCCTACTCTTGACCCTTCCGACGACGACTA
CGACGACCGCAACGAGTAGCAATCATGTCTTTCGGAAGCTTCCAGTCAAT
ATGCGAGACGGCGAGTATACCACTCTGCTCGCTGGTGGGACCTTATGGCT
CGTCGAGAGTGATGAGACCGGGCATCGAGGCGCTGTGCTACTCACGAAGC
ATAGAAACGGCAAACACAATCATTTTCCAGCTTGCTAACGACTTTGTTCA
TATTCTCGCGCTGATTATGTGTTCAATAATGGTACTTCACGTACGGTCGA
AATTCACCGCTGTTGGTCGGAAGGAGATCACCTCATTCTTTTACCTGTTT
ATGCTCCTCACTGTCATTTCCCTCTGCCTTGATTCTGGCGTCATCCCCAT
CGGGTCGGCTCCGTACGCATACTTTACCGCTGTCCAAGCCGGCTTAACAT
CAGCCCTATGCACATGTCTTCTCATCAACGGGTTCATCGGGTTTCAAGTT
TACGAAGATGGCACCGCGCTATCAGTATGGCTCCTGCGACTCTCGACGGT
AGCAATGTTTATCGTGACCGGCGGCGTCGCAATTTGCACATTCCAAAGTT
GGATCGGACTAAGCCCCACCAAGACTATGGCGCTCTTCGTCGTCCTCTAT
GTTGTTAACGCTCTTTTCCTCTTTGTCTACGTCGCCTGCCAGGTCATTTT
GGTCATGGCGACCCTGGAGGACAGATGGCCGTTGGGTGACATCGTCTTTG
GCGTTTTCTTCTTCGTCGTGGGACAGGTACTTTTGTACGCTTTCAGCGAT
AAGCTCTGTGACAAAGTTTCTCACTACCTTGACGGATTATTCTTCTCTTC
TATCTGTAACCTTCTAGGTGTCATGATGGTCTACAAGTACTGGGACTCCA
TCACAAAAGAAGATCTCGAATTCTCCGTCGGCACAAAAACCAACGTGTGG
GAAGTCAAAGAGTTAATCCCGGAGGAAGACCGTCGCACGACCATCTTCGA
ACACGCCGGTCCCACTAGCGATTGCGCAACAAGCACATACAACTCGAGCG
GGAATCGCGTGAGTCAGGGATATGGTGGGTTCTCTGATCGATACTAGCGC
CCCCCCTCTTGACCCTATATCCTCCTTCTTTCATTGAAAATCTTGGGTTT
TTCATGCTTTCTTATTTTTTTACTAGGGGCGTAAATGGCGTATAGACCTG
TTTTCTTTTCTTGTTTTTGTTTAAATTTTTTTACCTCTTTGGTAGGGGCT
TTGGCTGCTATCGTGCTCTACATAACCATTTATTTTCCCCTTCTCTTTCA
ATCTTGAGGGGTTGTTTTTATTTTACCGAAGATGGGAAAGGCAGACGGAA
GAGCAAACATAATATACCACTTGGCGGTTTTAGATGTAGGATGTTTTTTA
TTCTTTTGGTGGTGGTGATTTTTCGGCTTCTTTTTTCTCTTATCACCCCC
TTCCTTTATTGTAGGCAATGCCCGAGGAGGAAGGGAGTCTTTATATATAT
ACCCTATCGCACTTACTCATGTTCACAATACCTGCTGTACCCATTGTATC
CTACCCTCAGCACCTTTCTTTCTCTTCCCCTTTCCCCCTTGTCCTAACTA
CCCAAATACCATAGTGGTGTGATATCACCAAAACCGAGTCAGCACCAGAA
TTCAACACTCATATTATAATATACCTTTCCCTCTCCCCAA

Sequences in the Contig:

SY0AAA23YA17FM1 SY0AAA33YI05FM1 SY0AAA42YH06FM1
SY0AAA9YG16FM1 SY0AAC15YJ20FM1 SY0AAC18YD22FM1
SY0AAC2YK06FM1 SY0AAC46YC08FM1 SY0AAC53YI21FM1
SY0AAD16YD22FM1 SY0AAD18YP16FM1 SY0AAD49YC14FM1
SY0AAD59YB05FM1