Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4326
Length(NT) : 906
Best Gene Model Blast : Link to GSTUMT00009541001 E-value : 2e-56
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4326
TTGGATCAGTTTTAACCAGGAACAATCCAATTGTCTCGTCGAAAACTTGT
GCGACAATTAGTAATGCCACAAAATCAACCTGATCGCTTTCACTTGTTCT
CATTCAGCTCTCCGTTTGATTATTCTAATTAACTAAACGGTAAAGACAGG
AATATATAAATTACAGGGAAGACCGATGTCGCCCCATATTTCCCTTGATT
ACCACATATACACTCTCGTCCAGACAAGTCTCCTTTTCCTCTGGGTACTC
CACGCTAATAAATGAGAGATAGGCTTCATAAAGGCTCTCACCGTCCGTAA
ACCCCGCTCCGTTCCTTTGACCCTCCCGTATTACTTCCGGCGGGACAATA
CCAAAACGACAAAACGAAACGGCGATGACTAAATGCGCTGTGAATACTCT
GCACAACCAAAAGCGGGGAAGTTCACTAAAGTTCACCAAGGTCGCTCCAC
ATCTCGCTCTTTCAACGACTCTCTCGCTCTCTGCTTTCTCGCACTCCACG
ACTCCACGACTAACTAAACTAACTGACAGGAAAAGACAGCAGTATAAATA
AACGACAAAGATCACCTATCCTATCCTTCCTGCGATCACCGCATACCGGT
ATCTCTGACGCCTCCCATACTCATCTCCATTTCCTCTTGTGCGCTCGCAT
GCTATCAATCATGCTAACGAAAGAAAGGAATGATAGACTCCAATTGCCTT
CCGTGCTCCCATTGGCGTCCGCGCTCCCACTGCCTTCCAACGCTTGCGTG
CTAACAAAAGAAATTCGGAAACAAAGACTCTCGACTGTCTCTATATCCCC
TGCCATTCATATCCTTCTTCATAGGAAGTGCTCTCCCAAAGTGCATAACC
GAAACCTCCCCCCAACAAAGCGAATGCGCCAAAACAACAAACAAGGGGCG
GGGGTG

Sequences in the Contig:

SY0AAB10YI06FM1 SY0AAC28YD09FM1 SY0AAC2YJ20FM1