Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4325
Length(NT) : 698
Best Gene Model Blast : Link to GSTUMT00005146001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein CIMG_02611
Accession: ref|XP_001248840.1| Score: 304 E_value: 4e-26
KEGG Definition: hypothetical protein
Accession: ang:An15g00160 Score: 264 E_value: 8e-22
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1104 Score: 171 E_value: 3e-13
PFAM Definition: No Hit Found

Sequence:
>Contig4325
TTGGCACCAACACACCCCTGCGGTCACACGTCGACCACGAAGGCAAAAGA
TAAAAAGATAATAGCGACGAATAATGGGCGATTACTACCGTGGAAGAGAA
GAAGGTCGTGGAGGAGGTAGAGGGGGGGGTCCGAGACGCTCTCAGAAGAG
ACGTCACAGAGACGATGACGATGATGATAAAGAATATCGACGCTCACGTC
CGTATGAGAGGGAGGATCCAGCCTCTAGATTGCGAAGGGACACCATTTCA
ATCGCAGAATCTCCTCTGACCAAAATTGAGGAAACCATCAACCTAATTGC
AAATACTTTCGCCTCAAATTGCGATAGTGAGGAGCTCCGCAATACTTTCC
TCAATACCTTGCTCTCTCTGGTTGTTGAGCAACCTTTCAAAATTCCTTTC
CTTACGGCTGCTGTTCTTGTCATCAATTCACGGAATGCCGAAGCTGGGAA
GTTGATCCTCGATGAATTTGGGAAGGCTGCACAGGCATATCTTACTGAAG
GATTCCTCACTAGTGCAAAGCTTGTCTTGCGCTTCCTCGCCGGGCTTCAG
GGAATGGTGGAAGGCGAGGGATTATACTTTGTGTTGGGCGGTATAGTCGA
TCAGGCTGCCGGTTATCTTGCTGCGGAAGAAGTGGGACTGGCCCTGGACC
TGGTGTGGATTACATTAATAACTGTTCCCTACATTCTCGCCTCATCAA

Sequences in the Contig:

SY0AAA14YI23FM1 SY0AAA4YP06FM1 SY0AAC29YP24FM1
SY0AAC2YJ16FM1 SY0AAC30YP05FM1 SY0AAC35YG09FM1
SY0AAC4YK09FM1 SY0AAC57YO23FM1 SY0AAD14YN23FM1