Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4324
Length(NT) : 991
Best Gene Model Blast : Link to GSTUMT00001661001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0199 Score: 149 E_value: 1e-10
PFAM Definition: CDC27, DNA polymerase subunit Cdc27. This protein forms the C subunit of DNA polymerase delta. It carries the essential residues for binding to the Pol1 subunit of polymerase alpha, from residues 293-332, which are characterised by the motif D--G--VT, referred to as the DPIM motif. The first 160 residues of the protein form the minimal domain for binding to the B subunit, Cdc1, of polymerase delta, the final 10 C-terminal residues, 362-372, being the DNA sliding clamp, PCNA, binding motif..
Pfam Number: pfam09507 Score: 131 E_value: 2e-08

Sequence:
>Contig4324
TTGGGGTCGATCCATGTCCGCCGGCCCCGCAGTCAACCAGGCCAGCGAAG
CCTGTGCCCCCGCCAAGCATAAAAGTTACTGGAGACGCCGCAGAGCCGTC
GCAAGTCTCACCAACCGGGAAGAAGCCGAGCGGTGGTGAGCCGATGAGTA
GATCTAATTCACAGACTGCTCCGGCGACAAAACCGGCTACGAAGGCAGGG
CAAAAGGATGCCATTTCCCGGATAATAGGCAAGAAGGGCACGAAAAAGGC
TGCGGCACCCAAGGCTAAAGCAGCCACTGTGAAAGCTCCAAAGTCGGCCA
ACACCAAGGCTACCAAGGCTGCAGCTGCAAAAGAAGCTTGCGCCACAGGT
GCGAATTCGAAAATTAAGTCTGCAGAGAGGGTGGAAGATTCCGACGAGGA
TATTGAGATGGTGGATGTGAAGCTATCACCCGCTAAGCCGGTTGAGAAAA
AGACTACTCTGGCAACAAGGCCAGCTCCCAGCCCAATGTCTAAGGCTCCG
TCAATAGCATCCGCTCCAGCCTCGGATTTGGAGGCGGAGGAAGCAAGGCT
GAAGCCCAAAAAAGCCTTGTCTAACAAAGTGCAGAAATCCCCTGTCAAGA
GAGCCAGGAAAATCGTACCTCCGAAGTCGTCCAACACCGCCACGAAGGCA
AATGGGTACAAAGTTGCACCTACATCGAATGCGAGTGCCAATTCACTTTC
GTCGAAGGAGCAGATCGTCCGACGTAGCTCGAGCTATTCTCCGCCCAAAC
CCTCGCCTCTGGGGTCATCGCCGCCGGTCAATGCATCGGACATGGGTGGT
ACAACGGCCGCTTCCTCACCTTCTCTCTTAACGCCGAGCATGAGAACGGC
AACACCTGGTCGGTCACCGCTGGGTTCGGTCGCGCACCCTGCGAAGGCAA
AACCGCGCTACATCCCGAATAGCTCTCCGCCATTAAAGAGAAAGGCCACT
TTGGCGGCAGACCGTGACCGTGAGGATGGTTACTCACGACC

Sequences in the Contig:

SY0AAA46YE18FM1 SY0AAC2YJ09FM1 SY0AAC30YJ05FM1
SY0AAC33YB16FM1 SY0AAC5YG19FM1