Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4323
Length(NT) : 1214
Best Gene Model Blast : Link to GSTUMT00002332001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: hypothetical protein SS1G_10383
Accession: ref|XP_001588835.1| Score: 682 E_value: 1e-69
KEGG Definition: alpha-1,6-mannosyltransferase subunit, putative [EC:2.4.1.-]; K05532 mannan polymerase II complex MNN11 subunit
Accession: afm:AFUA_4G10750 Score: 672 E_value: 9e-69
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4748 Score: 562 E_value: 3e-58
PFAM Definition: Glyco_transf_34, galactosyl transferase GMA12/MNN10 family. This family contains a number of glycosyltransferase enzymes that contain a DXD motif. This family includes a number of C. elegans homologues where the DXD is replaced by DXH. Some members of this family are included in glycosyltransferase family 34..
Pfam Number: pfam05637 Score: 628 E_value: 5e-66
Swissprot: Q09174|GMA12_SCHPO
Gene Ontology:
GO:0000139 = Cellular component: Golgi membrane
GO:0031278 = Molecular function: alpha-1,2-galactosyltransferase activity
GO:0009272 = Biological process: fungal-type cell wall biogenesis
GO:0042125 = Biological process: protein amino acid galactosylation
GO:0006487 = Biological process: protein amino acid N-linked glycosylation
GO:0006493 = Biological process: protein amino acid O-linked glycosylation

Sequence:
>Contig4323
TTGGTCAGTTGAACCCTTTTTTTCTTCGAGGAAAGAAAAGGAGAAAAATA
ACTTCAAAACAGCTGTAGATGAGTTGAACCTTCGGACCCAGACACAGACG
GATAAAGTCTCCCCCACCCACAGTCCTGATTTCGGCCTCCATCGGCCACA
CCACACTCATTTCTCGCTTTCTTCTGCCTTTCCTCACTTGCGGTCATCTA
AGCAGAACCTTCAGCCCTCACGAGTACCGAAGCCTGTGATGCACTTCGCA
CTTCCAGCGAGGAACCATCGTTCCTCCCCCTTTCCCGCGAGCAGTGTCCC
ACGAGCATACTTTTGTCGAAAGAGACCACTGTATGCGGTGGTATCCCTTG
CGATACTACTGTTGATCGCGTTCGCCCGGAATTCAGGGGATGGGAGACCA
GCGGGCGCACCCAACACGGTGATGATTCTATTAACCGACAAAATCGGGTA
CTCGGAAAGTTACGTCGACAAGATAATAAAGAACAGAGGGGAGTACGCTG
AAGCGCACGGCTACGGACTCTTCATCAGGGACGTTGCGGACTACCCCATC
GGCGAGGTACCAAACGGCTGGGCGCGCATCCCCGCCATCAGACATGCCAT
GAAGGAATACAAATACTCCACCTACTTCTGGGTGCTCGATCAAGACGCCG
TAATCATGAACCCCTCGCTCTCGCTAGAGGAGCACATATTGTCTCCCGAG
AGACTAGATAGCATCATGCGCAGGGGTGTACCCGTTGTCCCGCCGAGTAG
CATTATCGAGACGTACAAGCACGTCCCCCCGGAGAGGGTGCAGCTCATCA
TCACACAGGATGATGAGGGATTGCAGCCCGGGAGCATGATTCTTAAGGCG
GGGTCGTGGGCTAATTACCTTCTTGACGCTTGGTTCGATCCGATTTTCAG
ATATTATGGGTTTCAGAAGGCGGAACAACACGCTCTTGAGCACATTGTTC
AATGGCACCCTACAGTCCTGACCAAGATGGCCATGATCCCGCAGAAGATA
ATGAACTCTTACCCCAATGTACCAGGCCTCGGTGGAACCTACGAGGATGG
AGACTTCCTCGTCCATCTCAAGGGTTGTGCTGAGGGAAAAGGCCGGAGTT
GCGAGAAAGAGTTCCAAAAGTACTTGAAGAAGCGGACTCTGTTGAAGTAA
ATCTAACGATGGTTTACTCGCCTAATACTCCTTTATCTCTCGTATAGAAT
TTTATCACATTTTC

Sequences in the Contig:

SY0AAA2YE03FM1 SY0AAA2YK09FM1 SY0AAA35YD13FM1
SY0AAA57YL21FM1 SY0AAB38YN16FM1 SY0AAB55YD12FM1
SY0AAB59YI22FM1 SY0AAB6YP14FM1 SY0AAC2YI16FM1
SY0AAC52YC01FM1 SY0AAD32YI01FM1 SY0AAD32YI14FM1