Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4322
Length(NT) : 1036
Best Gene Model Blast : Link to GSTUMT00000208001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein CIMG_09813
Accession: ref|XP_001240192.1| Score: 227 E_value: 6e-17
KEGG Definition: hypothetical protein
Accession: ncr:NCU02936.1 Score: 194 E_value: 2e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4322
TTGGCCGGATGATCCACTTCCTCGAGCACGATGAGGTGGGAGAGGGAGAG
AGAAACAAGAGCTCCCATCATGGTAGGACAGAGAGGGTCTATGACACCCA
CCTGCTTATTTGTGTGGTTTTGGTCTCATATCATGGTGTGTATGATATGG
TATCATAGCTTTGGTGAGCATGGTGCCCCAAGTAACCCCCCACCCCCGTA
CCTACAACTGCTCATCCCATTTCTCACGATCCTTCTTCTCTTCTACCCTC
CCCTGACTTCCTCCTCGTTACGTCCGCTCTTCTCTTTAGTCTCCCACTTT
CACCACTATCACCACCAAGCACTTGTTCTGCTCCATCCCCGCCACTACTT
CCATCTTCCACTCTCACCTCACTATATACGAGGGTCTTCAGCTGGGACAG
GGGCAATTCATGGCTCTTCACCAGACTCGCATGCTTCTACTCACTCGTGC
AGTACCCCTTGCAAGACCACTGAAAATAATTAGATCCGCCTCCACCATTT
CAACACCGAGTTCCAATGTTGGTATCACGCCTTCATCACCACAACAGGAA
GCTTCCGAGCTCTCTGTGAGATCCTTCGTGGCCCCTCCTCCAATCGCAGC
AAGCGACCACCCGTTGGCTCGTCTATCGACCGCTAGTTTGCTTCGTGCAA
TGCTTCTTCACTCCTTCACAGCTTCTCCTTTTCTGTGCAAACTTGGGACC
AAATTTATTATGATGAATCTCGACAGCTTGAAGAAGGGCGGTTTGATGAA
ATGGGGAGTCGACAAGACTTTCTACACTCAATTCTGTGCTGGATCCACCT
CTGCCGAGATAACTGCTACCATCTCTGAGCTTCGTTCCCTTGGACTCGCA
GGTGTTATTCTTGCATACTCCCGCGAAGCCGAAATTACCGATACTGCTGC
GTCTTCGGAGAGCCAATCGCAACAGATCAAGCAGTGGTTAGATGGGTCGT
TGAAGACAATTGCATGTGTTGAACCGGGTGATTATGTTGCCATTAAGTAC
TCTGGTGCTGGGCTCTCCTCACTTCCACTACTCAGT

Sequences in the Contig:

SY0AAC29YC21FM1 SY0AAC2YH14FM1 SY0AAC36YK04FM1
SY0AAC56YI05FM1 SY0AAD42YK03FM1 SY0AAD48YI03FM1