Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4321
Length(NT) : 1484
Best Gene Model Blast : Link to GSTUMT00012232001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein An12g07950
Accession: ref|XP_001395846.1| Score: 935 E_value: 8e-99
KEGG Definition: hypothetical protein
Accession: ang:An12g07950 Score: 935 E_value: 4e-99
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG2662 Score: 787 E_value: 2e-84
PFAM Definition: CorA, CorA-like Mg2+ transporter protein. The CorA transport system is the primary Mg2+ influx system of Salmonella typhimurium and Escherichia coli. CorA is virtually ubiquitous in the Bacteria and Archaea. There are also eukaryotic relatives of this protein. The family includes the MRS2 protein from yeast that is thought to be an RNA splicing protein. However its membership of this family suggests that its effect on splicing is due to altered magnesium levels in the cell..
Pfam Number: pfam01544 Score: 365 E_value: 2e-35
Swissprot: Q4WCV3|MRS2_ASPFU
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane

Sequence:
>Contig4321
TTGGCTAAATTTACAGAGGAAAAAAAATCCACGCGCTATCATACATAGTG
TCTCTCTTCCCAAATTTGTTTCCCTCTTCCAAAACCCCCACTAAATGTTC
CAGCAACAGCAATCATAACCACTCCCCCTCCACTCTTCCTACATCGCTAA
CCCCCCCCAAATTCTCTCCCTCCTTCTACATGCACGCCCACATACCACGG
TCCGCCTATTCACCCTCACTACCACTAGTCCTCCGACGTTCGTTCCTGGT
ACCTCAATGCCAGCAGCTCCCCTTCTCTTCTGCCCGGCGACAAAGTGTAG
TCTCCCGGAGGAGCTATACCAGCACCCTCCCACCAATTTCCCGGCAACGA
CCAATAGCGATGATGATGGAAGCGGGGTGCTCAAGGCCGCGGGCAACTAG
CTCGAGGATGAGCTCGAGCATTATAGAGGCGTTATTTGGGAGACGGGTCA
AGAAGGGATTGGAAAGGGAGGCGGGGGTTAGTTCGAGATATTTGGACTCC
GGGACTGAAGATGCTATTCTGGGGCGGAGCTTGCTATATAAGAACCACAA
TGATGAATTCTTAAGATGCACGGAGTTTGATCGGGAAGGAAATGTCACGG
TGGTGTCTGGGGAGTTTAAGAAGAATGAGCTGTGTGCTAAGCACGGATTA
ATGCCTCGAGATCTCCGGAAGCTTTGGGTACCCAGTATAATCGTACCGCA
TATCCTCGTCCGGAAAAACTCAATTCTTGTCAATCTATTACATATCCGGG
CGCTGATCAAAGCGGACACAATCTTGTTATTTGACGTCTATGGCTCGACC
GACTCTTACACACAATCGGTCTTTATGTATGACCTCGAGGGGAAACTACG
GCAAGGATCAAAGGCTATGGGTGGCCTCCCATACGAAATGCGGGCACTGG
AAGCGATCTTGATCTCCGTCACGGCTGCCCTAGAAGCTGAAATGAAAGTT
TTGCAGGAGCTTGTTATCACCTTACTTGGGGAACTAGAAGAAGATATTGA
TAGAGACAAATTACGGCTATTGCTGATCTACTCGAAGAAGTTGTCAACAT
TCGAACAGAAAGCTAAATTAATTAGAGATGCTATCGAGGAGATCCTAGAA
GCGGATGACGACCTAGCAGACATGTACTTGACAGAAAAGATGTTGGGGAA
GACCCGGCCGACAGAGGAGCACACGGAGATTGAGATGCTACTTGAATCGT
ATCATAAGATATGTGATGAGATTGTTCAAATTTCAAGTAATTTAGTCTCT
AGCATTCGGAATACCGAGGAAATTGTCAATATCATCCTCGATGCAAACCG
TAACTCCCTCATGCTCCTCGACCTCAAATTCTCCATCGGAACCCTGGGAA
TTGGTTCGGGGACCTTCATAGCCGGTCTCTACGGCATGAATCTCAAAAAC
TTTATCGAAGATTCTGATCTAGCCTTCTGGGGCGTTTCTGGCTGGGCATT
CATCTTCTCAGCGATAATATGCTCTTATGGGCTC

Sequences in the Contig:

SY0AAA10YH02FM1 SY0AAA37YF19FM1 SY0AAA42YI16FM1
SY0AAA5YI23FM1 SY0AAC2YH05FM1 SY0AAC49YM09FM1
SY0AAC57YM01FM1