Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4320
Length(NT) : 1173
Best Gene Model Blast : Link to GSTUMT00003873001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_08500
Accession: ref|XP_001553133.1| Score: 1078 E_value: 1e-115
KEGG Definition: hypothetical protein
Accession: fgr:FG01544.1 Score: 1029 E_value: 1e-110
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 125 E_value: 1e-07
PFAM Definition: No Hit Found
Swissprot: Q01317|NUC2_NEUCR

Sequence:
>Contig4320
TTGGAATCCTACCCGATGCGGAAGGACTATATCCACAGCACCTAGTTGCA
CGGTCCGGCAAGTCTGTACAGCTTCTGGTGACATTAAAGCAATATGGGGC
AAACCCAAACGAATTGGATAAGCTATTCCAGTGGGCTGCTGTTTTCCATG
CTGCGAGCGAGGGACATGTTGAATGCTTGAAAGCGTTGTTGGAGAGTGGA
GCTCGAGCGGATTTAATTGACGAGAAGGGGTTATCAGCAATGTATTATGC
AGCCTGGGAAGGTCATCTAGAGTGCATGCAGCTTCTTTCTGCTGCTGGGG
GGGCACTTGGAGGGTTAGGGACTGCTGCTCCAATGAGACCGTCGCCGGCG
TCTATTGCTTCGACAGTATCTGGAACGCAGATGACTATCGATTCTGATGG
AATTCCGGATCTTTCTCTTCCCCCTCCTATACTTCCCCTCCGAAGATATG
GGCATAATTTCCTGGAGAATAAGACATTTGTTCAGCTGGCGTTCGACGAA
ACAGATAGCAAGCCAATTTCATTCTATCACGAGGGCAAACACCCCGCTGC
AAGGCTCACCATATCGTCGAAATCATCCGACCTTATTCCTCGAAATATAC
TTCTTCCTCTAAATGAAGATGCAAAGATTGTTTCTTTCCAGATTGATACA
TTAGATATGTTTACCATTGACTTTGATATTTATCCTACATTTGGATCCAA
GGTCATCGCGCGCACGGTGGCTTTGCCTAATACCTTTAGCTCCCGGAGCT
CTGGGCACTGCGTGCTACCGCTCTTTGACTCAAGACTTAGAGCCATCGGA
CAGATTTCATTCAACTTCCAAATTATCAACCCGTTCCAGGGTGTCCCTCT
GGAGATTACCCACTTTGCGACGTACTGGAAGGCGACAAATCAGTTTGATT
CACATCCAAACGCACTTATCACTGGGTCGTCGTTAGCTGGAGAATATGTC
AGACTCTGCATCCAGCTCACCAGCGACGGAGTACCTGTTGTATACCCTTC
ATGGAGTATTCCATTTAGTGGGCTTGAAGTCCCCGTTTGTAGTGTCACTC
ACGCCCAATTCCAGAAGATAGGTGCCCAAGCGGGAAGTGAGGAAGCCCAA
CAGCGTTTGCCCAATATTCAAAGCTTGGCAGAATTACATTTCCTTCTGGC
ATACTCGTTCCTGACGCTCCAGA

Sequences in the Contig:

SY0AAC11YE03FM1 SY0AAC2YH03FM1 SY0AAC3YG15FM1
SY0AAD50YM21FM1