Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig432
Length(NT) : 647
Best Gene Model Blast : Link to GSTUMT00008083001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein An11g06610
Accession: ref|XP_001394639.1| Score: 582 E_value: 2e-58
KEGG Definition: hypothetical protein
Accession: ang:An11g06610 Score: 582 E_value: 9e-59
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG3199 Score: 442 E_value: 9e-45
PFAM Definition: CTP_transf_2, Cytidylyltransferase. This family includes: Cholinephosphate cytidylyltransferase. Glycerol-3-phosphate cytidylyltransferase..
Pfam Number: pfam01467 Score: 114 E_value: 1e-06
Swissprot: P53204|NMA2_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0004515 = Molecular function: nicotinate-nucleotide adenylyltransferase activity
GO:0005515 = Molecular function: protein binding
GO:0019674 = Biological process: NAD metabolic process

Sequence:
>Contig432
TTGGCCCGCTCCTACAGCCACCGCAACCAACACCAACGCCCTTTGTCGTG
ACGATCTCTCAAACCCAGCAAGAATGTCTTCTTCCCCAGGCTTGCAATCT
AAGGATACCTACACCTTTCCATCTCACCGTCTTCGACAGGTATTGAACGA
TCCCACCAAAATACCCTTGGTCCTTGTCGCTTGCGGCTCTTTCTCGCCCA
TCACCCACATGCATCTTCGAATGTTCGAGATGGCTGTCGACTATGTACGC
CAGAATATGAGTGATACCTATGAGGTTGTTGGTGGCTACCTGTCACCTGT
GAGCGATCGGTACAACAAAGCTGGTCTGGCAAACGCCACCCATCGGGTCC
GCATGTGCGAATTAGCCTGTGAACAAACTTCCGACTGGCTAATGGTTGAC
CCATGGGAAGCCATCCAGAATGAATACCAGCCCACCGCCGTCGTATTGAA
TCACATCACCACTTCCGTTAATGATCAACTCGGTGGAATTTCCACCAGCT
CCAATCCGGATACCCCCAAGAAGCCTGCGCAAGTTGCTTTACTCGGCGGT
TCTGACCTTTTGCAAACTATGTCGCAGCCGGGCGTCTGGTCTTTGCAAGA
TTTGGACTTGATTATTGGGTCCCACGGGATTTTCGTCATTGAGCGTT

Sequences in the Contig:

SY0AAA11YM10FM1 SY0AAA24YA11FM1 SY0AAA24YA11FM2
SY0AAA25YA11FM1 SY0AAA54YE01FM1