Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4319
Length(NT) : 1010
Best Gene Model Blast : Link to GSTUMT00012179001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CHGG_06541
Accession: ref|XP_001222636.1| Score: 396 E_value: 1e-36
KEGG Definition: hypothetical protein
Accession: fgr:FG08527.1 Score: 364 E_value: 4e-33
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1228 Score: 393 E_value: 8e-39
PFAM Definition: TYW3, TYW3 like. TYW3 has been identified in yeast to be involved in wybutosine (yW) biosynthesis. yW is a complexly modified guanosine residue that contains a tricyclic base and is found at the 3' position adjacent the anticodon of phenylalanine tRNA..
Pfam Number: pfam02676 Score: 239 E_value: 5e-21
Swissprot: P53177|TYW3_YEAST
Gene Ontology:
GO:0031591 = Biological process: wybutosine biosynthetic process

Sequence:
>Contig4319
TTGGAATGTCTCAGCAACTACACGCACGCTTTGCGGCTCACAAAACACAG
ATCTTAGCCGAAATTTTGTCTCCAGGGCCAGACGCATCCCCGAAAGGATC
CATCGACCTTCACATCCTTCCCTTGATTAATCGGCTAAACGAGCATCGTA
AGATCATTACCACGAGTAGCTGCAGTGGGAGAATAAGTGTTTTCCTGGAG
GGCTCGAAAAAGCTAGCTGGGGAGGGTTCTCGAGCAATCGGGGAAGCCCC
TGAACCAGACGAGAAAGCTGAATTTCCCTCGGGTAATGCGGGCATGGGTG
GAAAAGGTGGGGGAAAGTGGTTGTTTGTTTCCCATGACCCTGTGGACTGC
AATGATATGACTCCAAGAGAAGTGTGTCAAATGTTGCTTGGAGGGCATGT
TCTCGGTTTAGGTTCTATGAACAATCAAGTTCTTACCGAGCCAGTGCTTT
CTGAAGCGGGAACTGGTGTCTCAAGCTCCACCCGGCTAGTCCACATGAAG
TTCGAACCTATGATACTCCATATACAGACCCTCGATCTTCAGACCGCTCG
TATTATCCTCACTGCGGCCTTATCGGCCGGTTTTCGTGAATCCGGAATCA
TGAATCCAGGGCTCACTGAACATTCGTTTCCCATGATTGCCATACGCTGT
AATGGATTAGTGGTGGACTCGATAATCGGCGTTATGAATGTCACCCCTTC
CGGTATCAAGATGATAGTTGATGAGAACTATTTGAAAACAATGATGCTTG
TTTCATCGTTGAGGTTTGAAGATAACAAGAGGAGGATTGATGCATTCAGT
GGCAAAATCGAGCAGGTCCTGTTTAATCAAGGACAAGCTCCATCAAAGGA
GAGCAAGGGAGAGCGGAAGATACGAAAACGAGAGGAAGGGTTAAGGAGAC
AGAGGATTTTAAGAGCCGCTCAGGCACACGGCGAAAGCCAACTCTAGACA
CTTCGTTGACGCGGAGCCGGCACAGCACTAAAGACATCCAATCTTGGTGC
GAAAGAAATG

Sequences in the Contig:

SY0AAC2YG12FM1 SY0AAC9YN03FM1 SY0AAD48YA12FM1