Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4318
Length(NT) : 1469
Best Gene Model Blast : Link to GSTUMT00003238001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4318
TTGGATTGTGGGCTAGCGAGTGCAAGTTCTCAACCCTTTCCTCGTCTTTT
CCTCTAATAAACAATCCAAAACGGTATCGTCTATAGACAATGAGCACCCC
AGAAGTCTGCCCTTCCTTCCAAACCCCCTTCTCAACTCCCGCGAACAACC
TCCTCTGGACACCCTCACCATCACCGACCACGTCAAGTGCGGCAGCAGAG
CCGCCGCCAAAGCCCTTGCTCACCCTCTCAGCGGCAGACTACACCTCACT
GCACACGTACATCACGACAACAACTGTCCTCCCTCAATCGTACCAGGCCT
ACAAAACCCTCTACCCGGACGTCCTGAGCCCGCTAACGGCATCGAACCTC
TACTCGAGAACGGGGCAAACACTCGTTTCCACAGCGGCACTGACAAAGTC
GTACCAACTCTCCTTTAGCGACATCTCGAGCATCGCCACTGCAATCATTG
GCTTCGCAACGGAGGCGCGGCTATGGTATCCGCGGCTGCAATCGCAGTTG
CAAGGACTGGATGCGACGCCTACGGCAGCGCGCCAAGGTGGGGAGTGGGA
GGGGAGGAGGGGGGCTGCGGTCACGGTGTTGAAGATCCTGTGTAATTTGG
CGGAGAGGAAGGAGGAGAGGATTGGGGTTATTTTAGCACAGTTTACTTCG
CTACGTGCCGAGACGTTACACTTAAAGTCTACAATTGAGGAAATCACCAA
TGAGCTGTCCGCTCTCCAAGACACCATAACAAGGGAATCTGCAGATAGGT
CGGCGAGGTTACAAGCCCTACGTATCCAGCGGGCCCTAGTGGAAGAAGAG
CGTAGTGAGCGCAATCGGGAACGAAACCGCGCGTTCCTCAATCTGGGATA
TATGTTCGTAAACCCCATCCTCGGCCTCCTCACCACCGCAGCGACAGTCT
CCAACGTCCAGACAGCATACGAGTCCAAACGCCGCGAGCGCAACAACCTT
GACGACGAAATCGGCGCCGTCCACCACGGCCTGGCTGACCTCGAGAAAGC
CACAATCACGACGTGCTCGCTGGAAATCGCGCTCACCGGCATCCTCTCCG
TCGTCGATGCCTTCTTGCAAGTGTGCGGTTCCATTAAGGCCACCTTCCGC
ATCATGCAAACGAACTTTGAGCTCGTGTCTACTTCCTTGCATGCTACATG
TGATTCCACTGCCGGTGATGGGTTTTCGTGGGCTATTGAGGACTTGCGGA
GGGCTTGCGAGGTTTGGGAGATGGTTGCGGAGAGGGCGTATGAGTTTCAA
AGTGAGGAGTTCTTGAAGGTTTGTGTTAAGAAGAAAGAGTAATCGGGGGG
TATTGCTGTTTCTGGATTAAGGTGGGGTTTATCGTGGGCTTGGTGGATTA
TGGTTGGGGGTTTCTTTTGTTAAAGTTTTATGGTAGGCTTGGTGTTTGCA
ATGATATATGTGCCCATATGATACGAAAGAAGGAACGCCGGGTGATGACA
AAAGAAATAACATCACCAA

Sequences in the Contig:

SY0AAA22YM16FM1 SY0AAB3YE15FM1 SY0AAC2YG02FM1