Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4317
Length(NT) : 1199
Best Gene Model Blast : Link to GSTUMT00004395001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_02376
Accession: ref|XP_001596160.1| Score: 1257 E_value: 1e-136
KEGG Definition: SMT3/SUMO-activating complex, catalytic component UBA2 [EC:6.3.2.19]; K10685 ubiquitin-like 1-activating enzyme E1 B
Accession: aor:AO090023000222 Score: 1243 E_value: 1e-135
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2013 Score: 1040 E_value: 1e-114
PFAM Definition: UBACT, Repeat in ubiquitin-activating (UBA) protein..
Pfam Number: pfam02134 Score: 254 E_value: 1e-22
Swissprot: O42939|UBA2_SCHPO
Gene Ontology:
GO:0031510 = Cellular component: SUMO activating enzyme complex
GO:0016925 = Biological process: protein sumoylation

Sequence:
>Contig4317
TTGGTAGGTGGCGAAGGAGACTGCCGGAAAATTCAACCCCAATGTCAAGC
TCGAGGCTCACCACGCCAACATCAAGGATCCCGAATTCAACGTCAAGTGG
TTCGGGGGCTTCAATGTGGTATTCAATGCTCTAGACAATCTCGAAGCGCG
GAGACACGTCAATAAGATGTGCCTGTCAGCGGATGTCCCTTTGATCGAGA
GCGGTACTACCGGGTTTGATGGGCAGGTTCAGGTTATCAAGCGGGGAAAA
ACTGAATGCTACGACTGCACGCACAAAGCAACTCCCAAGAGCTTCCCGGT
GTGTACTATCCGGAGCACACCTAGCCAGCCTATTCATTGCATTGTTTGGG
CTAAGAGTTATCTTCTTGTTGAAATTTTTGGAACCTCAGAAGAGAGTTCG
CCCGACCTAGACCCAACTGAGGATTCTGAGAATTCCCGCGAAATCGCAAA
TCTAAAACGGGAAGCGGAAGAACTAAAGAATATCCGCGAAAAGATGGACT
CTCCCGATTTCGCCGCTACCGTATTTAATAAAGTTTTTAGAGATGACATC
AACCGCCTTCGGTCAATGGATGAGATGTGGAAGTCCCGGAAGCCGCCAGA
GGCTCTTGACCATCAAATGGTCTCAGATGAAGCCAAGGGTATTGATGCCA
AGGTTTCTGAGAATGACCAGAAAATTTGGTCACTAGTGGAAAATTACATC
ATGTTCGAAGACAGTTTGCGTCGATTAGCGGAACGTGTACTGGATATGAA
GAGGGATCAGGTTGGAGATGAAGCTGCTCCAATCATAACATTTGATAAAG
ATGACGAGGATACCTTGGATTTTGTTGCGGCGAGTGCAAACCTGAGAAGT
TTGGTCTTTGGAATTAATGTGAAGTCGAAGTTTGATATCAAGCAGATGGC
TGGAAATATTATCCCCGCTATTGCAACTACAAATGCGATTACTGCTGGTC
TTTGCGTTCTGCAAGCGTTCAAGGTTCTTCGTGATGACTTTACCTCGGCG
CGAACTATTTTCCTCTCTCGTTTGGCGGACCGAGCTTTCTGCACGGAAAA
ACCCAGTCCCCCTAACCCCACGTGCGGAGTATGCAGCGTAGCCCGGACTG
CCATTGAGGCAGACATTGAACGAGCTACTCTTGGGGATCTTTTGGACAAT
GTATTGAGAGATGGCTTAAGATATGGAGGAGAAATTACCGTCATGACTT

Sequences in the Contig:

SY0AAB54YJ16FM1 SY0AAC2YF16FM1 SY0AAD2YN05FM1
SY0AAD61YN13FM1