Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4316
Length(NT) : 726
Best Gene Model Blast : Link to GSTUMT00006452001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CHGG_05820
Accession: ref|XP_001221915.1| Score: 152 E_value: 2e-08
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06453 Score: 141 E_value: 1e-07
KOG Definition: No Hit Found
PFAM Definition: SSB, Single-strand binding protein family. This family includes single stranded binding proteins and also the primosomal replication protein N (PriB). PriB forms a complex with PriA, PriC and ssDNA..
Pfam Number: pfam00436 Score: 128 E_value: 3e-08

Sequence:
>Contig4316
TTGGCCAAAAATCCCCATCACAGAAAACCTCCCCTCCCCTCTCCTCCTCT
TTTTCCCAACTTTCCTTTTCTCTCACACAAACTACCACCACCCCTTTCCC
CGCAAATCTTCAATCATACGCACGCATACACCCCACCCCACCTCGCCCGC
CGAAGGGAAAACAATCAAACAATAGCCAATTGACTCACTTTTCTCCTCTC
CGGCGATGCTCTCCCTACTCCGACGCCCTCCATCATCATCAGCTGCAAGT
CTTTCCGTTACCCGCTGCTACCGCGGATTCTCGTGCTCTTCCGTCTCCTC
CGCAGACATGTCGAGGATTACGATTTCCGGGAAATTAGTTAGAACCCCGG
AATTAAGTACTACCAGTAGCGGCCGCAAGTGCATCCGTTACACGATCCGT
TCGTGGCAGGGTAAAGAGAGGACGAATTTCTTCAGCTTCCTATGTATCAC
TGAGAATGCGCGGTCTATCGAATACTTGACCAGCATACCGCGGGGCTCTA
GGGTAGTAGCCGAGGGTCAATTTAGCCCATACCAAATTGCCAATGAAGAC
GGCTCCAAGGTCCAAAAGTATTCTATCTTCTCCAACTACCCAGACCTCTT
GCATGTGATTGAGAAAGCGGAGCCCGGGGCAGCAGCCGGCGAAGCCACTC
AAGCTCAAGAAGCATCTGCGCCCACCGAAGCCGCTCAAGCTCAAGAAGAA
CCTGAACCCACCGAAGCCACTCAAGC

Sequences in the Contig:

SY0AAA60YE22FM1 SY0AAC2YF13FM1 SY0AAD41YN12FM1