Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4315
Length(NT) : 1199
Best Gene Model Blast : Link to GSTUMT00004360001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein CIMG_00679
Accession: ref|XP_001246908.1| Score: 713 E_value: 3e-73
KEGG Definition: nucleoside diphosphatase (Ynd1), putative [EC:3.6.1.5]; K01510 apyrase
Accession: afm:AFUA_5G11010 Score: 676 E_value: 3e-69
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG1386 Score: 231 E_value: 6e-20
PFAM Definition: GDA1_CD39, GDA1/CD39 (nucleoside phosphatase) family..
Pfam Number: pfam01150 Score: 156 E_value: 3e-11
Swissprot: P40009|YND1_YEAST
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0016020 = Cellular component: membrane
GO:0005792 = Cellular component: microsome
GO:0017110 = Molecular function: nucleoside-diphosphatase activity
GO:0017111 = Molecular function: nucleoside-triphosphatase activity
GO:0006486 = Biological process: protein amino acid glycosylation

Sequence:
>Contig4315
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCGCCGGCTATCGACTTTG
ATATCAATCACTTTGTTGGTGTATCCGAATATTGGCACACCACTCACGAG
ATTTTCGAGACCGAGCATGATGCGAAAGCCTACGACTTTGCGACCTATCA
ACAGAGGGTGAAGGAGTTTTGTAGCCAAGATTGGGATACTATCGAAGAAC
TTGTGGAGAAGAAAAAGTGGGGGAAACGGGTTGACGAAGAAAAGGCTATG
CAGACCTGTTTTAAGGCGAGTTGGCTGATCAATGTTCTACACAATGGCAT
CGGGATTCCACGTGTTGGGCTCGAGACCAGCGGCAATTCAAACCATAACG
GAACCGAGGAAGTGATTGAGGCTGCCAAATCGAAGGGATTCCTCGACCCT
TTTCAGCCGGTTGATAAAATTGCCGATGTGGAAGTTTCATGGACGCTGGG
AAAGATGGTTCTCTACGCAGCCAGTCAGATTCCCCCACGTGATGGTGGAG
TAAATGCTGTTGGCTTTGGGAAGAACGTAATAGGCGATAATGGTCTTCCT
AATGATTTCGAGTACGCTGCGCCTCAGAGAGCATCGCATCATCCCGATAA
TTCAGGTATGTCGGGTGGTTCTGGGGGATCAAATTTCAGCATGGATGGCA
GCAGCGATCAAGCCCACTGGCATGATTCGCTCTGGAAGGAAGGTGACAAG
ACCCCCAGACGTATCCCCGGGCTCTTGCTATTCCTCCTCATATTCTGCCT
CGCCGGCTTCCTCCTGATGGGCCGGGAGCGTAGAGGAAGGTTTTGGAGAG
CCGTTAAAATCTCTGGCAGGCGTGGGAAACGGAAGGTCCTGGGAAGTCAC
GGTGTTGTGATGTACGAAAGGATTATGGAGGAAGGGCACAACCAATTCAC
CGACTTTGAGCTCGGCAGTGTGTCTTCCTCTTCATCTTCGGATGACGAAA
CCGGTGGTTGGAGGGCTAAGGGATCTTTATATGACCCACCGATTGGAGGA
ACTGGTGTCGATGCTGTTAGGTCTGGATTGGGCACTCGAGTTGGTAGTAG
GGAGAGATTGCCAATGACCACAAGAGGTGGGGATATCTCTCCGCGAGGAG
GTAGTGCCAGGGCTCGAAGTCCAATGCCTCCACGATAGTGTCTGTATTAG
GCGTTTTATGCATCCTTCCCTTTGCTTGATCAAGTTACTCTTTTTTTTT

Sequences in the Contig:

SY0AAA54YG19FM1 SY0AAA58YI12FM1 SY0AAC2YF12FM1
SY0AAD39YP14FM1 SY0AAD50YJ20FM1