Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4314
Length(NT) : 775
Best Gene Model Blast : Link to GSTUMT00007523001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: predicted protein
Accession: gb|EDR10011.1| Score: 444 E_value: 3e-42
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_1G06510 Score: 385 E_value: 9e-36
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 130 E_value: 2e-08
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 140 E_value: 1e-09

Sequence:
>Contig4314
TTGGAATCTGGGATATAATTCTCCCCCCCGCCCTCTCTAAAGCTTTAACA
AATACCCCGACCCACTCCCCCTCCACCCAATCAAACACAGCCCAATGGAA
ACAAACTACGCCCTCCTCCGCGAGTCCCTCACCCCAGCCATTCTCCAAAA
ATCCATCCTTTCTCCAAACCCCGCCACGGACCTAGAAGACCTCAGCGACT
TCCTAGACTACCTAACCCAAGAACTCTACACCTTCCTCCCACCACCCCTC
CAAACCGCCACACCCCTCTCCACCACCACCCTATACCACCCCCTAATCCC
CCCGCTCTCCACCCTCCCCCCATCAATCACGGAATCGCTGACAAACTACG
ACATAGTCCCCGACACCGACGACGTCGAGAAACTGATCTCGCGCGTGCTG
TCAGAGTACATCGACGCGGCGTGCACGCCGCCGCCGGAGTGGACGGGAGC
GGGGAGTAGGAACGATGCGTGTGAGATTTGCGAGAGGGTCGGAGTGGGGA
TTACGTATCATCATTTGATTCCGAAATCTACGCACGCAAAAGTAATCAAG
AGGAAGTGGCATCCGGAGGTTATGCTTGATAGCGTTGCATGGCTTTGTCG
ACCGTGTCATTCGACTGTTCATCGTTGCGCTTCCAATGAAGTTCTTGCCC
GGGAGTATTATACCGTTGCCCTGTTGCTTGAGAGGGAGGATATACAGAGG
GGGCTTAAGAATCGGTAGGATGGTTGGTGGTGGTACTGTACAATACCGGG
ACAAAAGCGATCGTCACTTGCTCCT

Sequences in the Contig:

SY0AAB29YI18FM1 SY0AAB42YK19FM1 SY0AAB48YN22FM1
SY0AAB58YH03FM1 SY0AAC2YD15FM1 SY0AAC39YP07FM1
SY0AAD36YJ05FM1 SY0AAD52YK19FM1 SY0AAD6YF16FM1