Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4313
Length(NT) : 684
Best Gene Model Blast : Link to GSTUMT00009010001 E-value : 1e-146
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001539998.1| Score: 367 E_value: 1e-46
KEGG Definition: phosphatidylinositol transporter, putative
Accession: afm:AFUA_3G09910 Score: 363 E_value: 4e-46
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1471 Score: 172 E_value: 2e-13
PFAM Definition: CRAL_TRIO, CRAL/TRIO domain. The original profile has been extended to include the carboxyl domain from the known structure of Sec14..
Pfam Number: pfam00650 Score: 170 E_value: 4e-13
Swissprot: Q10137|SEC14_SCHPO
Gene Ontology:
GO:0032153 = Cellular component: cell division site
GO:0051286 = Cellular component: cell tip
GO:0005634 = Cellular component: nucleus
GO:0005628 = Cellular component: prospore membrane
GO:0008525 = Molecular function: phosphatidylcholine transmembrane transporter activity
GO:0000910 = Biological process: cytokinesis
GO:0006893 = Biological process: Golgi to plasma membrane transport
GO:0015914 = Biological process: phospholipid transport
GO:0031321 = Biological process: ascospore-type prospore formation

Sequence:
>Contig4313
TTGGGTTGGATCACGCCTTCCTTCACTTTCACTCCACTTTACAATATTGA
CCGAGCCATAATACCTATATTCTTCTAAGACACCGCAGTTACCATGACCG
AACAAATTAACGCCATTATCGAGCCTAAGCTCGAACCGAAGTATGATCAT
TACGACTTTCCGATCACCAACCCCATGACGGGCAGTGGTCACTCTGGTCA
CGTTGATGCTGAGCAAAACGCAAAGCTCTTTCAGCTAAGGAGTGAGCTTG
AGAGCGAGGGGTGTACTGAGAGACTGGATACGCTGACTTTGCTTCGGTTC
TTGAGGGCAAGAAAATTCGATGTCCCATTGGCAAAGGCCATGTAGGTCCC
CTACCCCGTTTGTCGCTTTTGCGAATAGGGTTTGTCTGTTATCGATCGAT
GTTCAACTCAGGCCAATCCTTAGGTTCCTCGCTACGGAAAAGTGGCGAAA
GGAGTTTGAAGTCGACAAGATTGTTTCCACCTTCGAATACACCGAAAAGC
CCAAGGTATTCGAGTACTATCCTCAATACTACCACAAGACAGATAAGGAT
GGCCGTCCCGTATATATCGAACAGCTCGGCAAGATAGATCTCAATGCAAT
TTTAGCCATCACCACCCAGGACCGCATGCTCCAGAACCTCGTCCTGGAGT
ACGAGAGACTGGCGGATCCCAGATTACCGGCCTG

Sequences in the Contig:

SY0AAC2YC20FM1 SY0AAC4YL06FM1