Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4312
Length(NT) : 656
Best Gene Model Blast : Link to GSTUMT00002948001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59042.1| Score: 301 E_value: 7e-26
KEGG Definition: uncharacterized membrane protein, predicted efflux pump
Accession: aor:AO090023000502 Score: 301 E_value: 3e-26
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1347 Score: 147 E_value: 1e-10
PFAM Definition: No Hit Found
Swissprot: P38767|YHJ2_YEAST

Sequence:
>Contig4312
TTGGGCCCCTTGCTGGCGGGAGTCGGATTGAGGAGGAATTGACCAACCCA
GAAAGACCCTCACTTAGTTTAGTCGCTCACCACCAGCCAGGGCCTCCAAA
TCGGGTTCTTGTGGGCAACTATCGTCGCCCTTCTCTCACGTTTAGCACTT
GCCCTGTGGCAATCCCTTCCTCGCCAATTCCTAGAAACCTAGAATATCTG
CCGCCGCCCGAGAGTGAAAAAATGGGTAGAGAGGAGCAAGATTTGTTGAA
GGGTAGTAAGGTGATCTCGTCAGATTACGGAACCCTCGCTACGTCTGCTC
GGCAAGCCTTGTCGTCCTCGCCGTCGTGGTCGACAACACAGGACGGTGGC
AGCTTAGAGACGACACTTACTACAGAGACAACAGGCCTTCTCGGGGGTCA
CCCTAACAATATATCAAAGTGGGATGAGGCAGCCGCTGCTGGCACAGTGT
ACACTTCGTACACCAGAGAGGCAAGGATGCTTGTGAAATGCACTGCGCCT
TTATGGCTCACCTTCTTGCTACAATACAGTTTAACATTTGCATCTCTCTT
TTCAGCTGGAACGTTGGGGAAAAATGAACTTGCTGCTGTTACCCTGGCAG
GCATGACTGCAAACATTACCGGCTATGCTGTATTTCAAGGGCTTAGTACA
TCGTTG

Sequences in the Contig:

SY0AAC2YC18FM1 SY0AAC54YI15FM1