Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4311
Length(NT) : 1131
Best Gene Model Blast : Link to GSTUMT00010339001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_13420
Accession: ref|XP_001548043.1| Score: 296 E_value: 7e-25
KEGG Definition: hypothetical protein
Accession: ncr:NCU06461.1 Score: 284 E_value: 8e-24
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q76C99|RF1_ORYSI

Sequence:
>Contig4311
TTGGGGAGTTGGTTGCGCCTGTGCTTGATAGTGCTATCCAGTACTACAAG
GAAGACCACTTCAAAGCCGGTGCTCGTCGGCAAACAGTTGAGGGGGGGGA
GGAGACGAGTGATATAGACCGAGATATGCTGTGGTCTTCTCTCCGATCGG
GCTTTTGGCTTTCCCACAGCCCTTCTGCTATCGCTTCGACCATATATCTC
ACCTTTCTTCATACAATGGAGGTTGCCACCCAACATCACAGGGATTTGGA
GAGAACCTTGTTCGTTTTTCCTCAACTTCCCAATGCCACGTTTCTTGGGA
AATATATGGCACATCACTATTTTGAGGAGGAGATGCAAATCAGGCTTGTG
AAACTAGCGGAGAAATTTGGGTTCAAAAAGTTAATCACGGTACCCGGGCT
TCTCCAGAGAGAGACCGATCAATACAAGGACGGAGCACGGTTAAAGGACT
ATTACGACTCTCTCAGAACCCAAGCTGAAAGTTTCGGAATCCCGCTCTTA
GAGGAGAACTTTATGGTTTTTGTTATGGCTTTCATGAGCCTTGCAGAAAG
AGAAGTCGCAATCGAGATCTGGAACGACATGGCGAGAAGCGGGATTTTAC
CTAGGCCACGTTCGTGGAACATGCTACTGGTCGAGGCTGGGAGGCTCCAA
GACAGAGATCGATCCTGTCTTCAGGCTGTTTGGAAAACCATCATTACTAG
TGGTGTTGTCCCCGATGTCATCTTATGGACAACGCGTATTCACGCGTTGT
TCATGGCCGACCGCGCAAAAGAAGGAATGAAGGTTTTGAAGGACATGCAA
AACTCTGGGCTCAAGCCAACCACCGCTACCATCAACGCCGTACTCGACGG
GCTACTGAAACATCAGCACATGGACGAGGCCAAGGAAACGCTCCAGGTCG
CCACTAGAATGGGAATCAAGTCGGATTTGACGACTTATAATACGATGTTA
CGGGCACTGCTTCGATCGAAGAAGTTTAATGAGGCAATTTCGTTGCTACA
GGAAATGCAAGCTGCTGGTATAAATGCCGACATAGTCACCGCGACAACGG
TGTTGGATGGGATGTACAAAAACTCTCCCACCAAACCGGATTTGGCCAAA
GTTAAGAGTCTCCTGGAGTACATGGAGGCCG

Sequences in the Contig:

SY0AAC2YC02FM1 SY0AAC2YK19FM1 SY0AAD61YK22FM1