Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig431
Length(NT) : 883
Best Gene Model Blast : Link to GSTUMT00000725001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SNOG_00305
Accession: ref|XP_001790995.1| Score: 294 E_value: 8e-25
KEGG Definition: hypothetical protein
Accession: ang:An11g09940 Score: 258 E_value: 6e-21
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1337 Score: 151 E_value: 8e-11
PFAM Definition: No Hit Found
Swissprot: P58467|SETD4_MOUSE

Sequence:
>Contig431
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAATTGGCAACCCACCAACA
AATGACCGACCGCAAAACAACTCCCACACCCGCCGTCACCGGCACGCATG
CCCTGTTCACCCTCTGGGCCCGCAAACACGGTATTGAATTCCCAAAACTA
ATCCCCGCATACCTACCCCCCGCCGGTCTTGGTATCATCTCGACCGACGA
AATCGCGGGCCCCGATCCAATCCGCCATGGAAGGACCAACGACACGAGTC
TCGGGGAAGTAATCGCTTTCACCCCGAACGCTCTCCTCCTCACCAGGGAG
AACATTGAGCGGTTCAGTCCCGGCTGTGGGCTCAGGTCTTTTTTGAGGCA
GAAGGTTGATGATGGCGGTTTGAGCTCGCATGCTGTGTTCGCCACTGCGA
TTGCGCGGGAGATCCGTAGGATTGCCGAGGGTCATGAGAACATGTGGAGG
GAGTGGATCGATGTATGGCCGAAGGCGAAGGAGTTTAGAGGGAGTATGCC
GTTGATGTGGTCGGCGGAAGAGGGCGATTTGTTGCCACCGAGCACTAAAC
GATTGCTGGACGAGCAGCGAGGAAAGTTCAAGAGAGACTTCAAAGCGGTA
GTGCAGAAGGGATTCGAATTTACCAAGCAGGAGTTTATGTGGGCTTGGAT
TATCGTCAATACTCGTACACTGTTTTACAAACCGGCCCACTCCGCTTACA
ACGACCTCCCCCGGGAGCATTGTATGGCATTGTGTCCTTTTATTGACTAC
TTCAATCACTCAGACGATGGCTGCAAGGTCCAACTAACACCAACCGGCTT
CACCGTGACCCCTACCAAACCCAGCCACCCAGCGAATACCCAGCTCTTCG
TAACCTACGGTTCTCACAGCAACGACTTCCTCC

Sequences in the Contig:

SY0AAA24YA07FM1 SY0AAA24YA07FM2 SY0AAA2YF01FM1
SY0AAA31YB17FM1 SY0AAA47YH10FM1 SY0AAD9YO04FM1