Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4309
Length(NT) : 689
Best Gene Model Blast : Link to GSTUMT00008989001 E-value : 1e-106
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein DEHA0E18216g
Accession: ref|XP_460061.1| Score: 513 E_value: 2e-50
KEGG Definition: hypothetical protein
Accession: dha:DEHA0E18216g Score: 513 E_value: 1e-50
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Cytoskeleton].
Kog Number: KOG1727 Score: 400 E_value: 7e-40
PFAM Definition: TCTP, Translationally controlled tumour protein..
Pfam Number: pfam00838 Score: 523 E_value: 4e-54
Swissprot: Q6BP09|TCTP_DEBHA

Sequence:
>Contig4309
TTGGATATTCTTCGTCTCTCCATTTCTCTCCACCAAACACTTTCAAATTC
GAACTCTCTGATCCTCAGCTTTAGAGATGATTATTTACAAGGATGTTATC
AGCGGCGACGAGATGATCTCTGACGCCTTTGACATGACCCTCGTTCATGA
TGTTGTGTACGAGGTGGACTGCTCGCTGATCACGGTCAGGAAGGGCGCTG
ACGTTGATATTGGTGCAAACGCTTCAATTGAGGAAGACGTTGAGGCGCTT
GAGGATGGGCAGGAGATTGTTAATAATGTTGTCCACTCCTTTCGCCTCGT
CCAGACAGGCTTTGACTGGAATAGTTATATGGTCCATCTAAAGGCCTACC
TGAAGAAAGTCAAGGAGCACCTCGCCGCGAATGACGCCTCACCAGAAGAG
ATCAAAGCGTTTCAGGCTGGTGCTAAGAAGTTTGTCGGGTCCAGGCTCAC
AAAGGAGTCGTTCGATGAAAAAAATTGCCAATGGGATTTCTACATTGGTG
AGGACATGAATGTGGACGGAATGGTTGTTCTCCTCAACTACAGGGAGGAC
GGTAGTACTCCATACATGATTTTCTGGAAGCATGGTCTCAAGGAGGAGAA
GGTTTAAATTCTAGTGCCAATCCTTTAGCTATTTCGAGAAGTGGGGAACC
AGTCGATTGCTGCATTTTCGCATTTCTCGGTTTTGTTTA

Sequences in the Contig:

SY0AAC29YO13FM1 SY0AAC2YA23FM1 SY0AAD13YM09FM1