Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4307
Length(NT) : 743
Best Gene Model Blast : Link to GSTUMT00011372001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SNOG_02250
Accession: ref|XP_001792865.1| Score: 370 E_value: 9e-34
KEGG Definition: hypothetical protein
Accession: ncr:NCU03548.1 Score: 337 E_value: 3e-30
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1462 Score: 277 E_value: 1e-25
PFAM Definition: NTP_transferase, Nucleotidyl transferase. This family includes a wide range of enzymes which transfer nucleotides onto phosphosugars..
Pfam Number: pfam00483 Score: 162 E_value: 3e-12
Swissprot: P56288|EI2BG_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig4307
TTGGACCTTCCTTCCACGTCAATGAAAATCCACAAAACTTGCACCACGCT
TACATAAACAGGGATCATAGTCCATTGCATAAGAGGTCTTGCTATCTAAC
AAATCCTATTCAACAAGACAAACATGCCCTCGAATCCTTCCAACGGCTTC
CAAGCCATTATTCTCTGTGGCCCGGGGACTTCCCTCTATCCCTTTACGGG
TGCTGAGGATCTCCCAAAGGCTCTTCTACCGGTAGCAAATAAGCCCATGC
TTCACTATCCTATCGAATGGTGTGATAGGGCTGGCTTTGATACGATCTTA
ATTCTCACCTTAACTGAGCACCAACCCGCAATTCAATCTTATCTCCGCTC
TCACCGTGCTCAAAAGTCCTCGGTCGAGATCCGGGTTGAATCACCCTCGT
CACTGAATGACAATCTTGGCACTGCCGACGTAATAAGGATAGCACACAAG
AAGGGATGGATCCATGGTGACTTTGCAGTATTACCCTGCGATTTGGTTAC
CACCATGGATTCTCAAGAGGTTATGGAAATGTGGATGGTTGAGCAAGCAG
GTTTCGATTCAGATATGGGGAGGCGACCAAGGCTGAGCAAGAAGGCTGGT
GATGCCGATGATGGACGGCGTGGAGGATTGGGCATTTGGTATGAGACTAG
GGGCGAGGGTGCAACCAAGGGAATGGAAACCGATTTCATTGCGGTTGTCC
CACGCCCTACAGAGAACCAATCGACCTCCAAGTGTCGCTCGAA

Sequences in the Contig:

SY0AAA42YL13FM1 SY0AAA45YJ10FM1 SY0AAA55YL08FM1
SY0AAA9YL03FM1 SY0AAB26YG06FM1 SY0AAB51YC19FM1
SY0AAC2YA13FM1 SY0AAD21YG07FM1 SY0AAD50YM11FM1