Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4306
Length(NT) : 801
Best Gene Model Blast : Link to GSTUMT00010159001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein NCU02943
Accession: ref|XP_965625.2| Score: 583 E_value: 2e-58
KEGG Definition: hypothetical protein
Accession: ncr:NCU02943.1 Score: 583 E_value: 1e-58
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2832 Score: 451 E_value: 1e-45
PFAM Definition: NIF, NLI interacting factor-like phosphatase. This family contains a number of NLI interacting factor isoforms and also an N-terminal regions of RNA polymerase II CTC phosphatase and FCP1 serine phosphatase. This region has been identified as the minimal phosphatase domain..
Pfam Number: pfam03031 Score: 399 E_value: 1e-39
Swissprot: Q874C1|TIM50_NEUCR
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane

Sequence:
>Contig4306
TTGGGCGTGCATAGCACGTGGGACCGCGAACACGGGTGGAGAATCGCGAA
GCGTCCAGGCTTGGACTACTTCCTCGCTTATCTATTCCATTACTACGAAA
TAGTAGTCTTCACAAGCCAGCACGAGCAAACCGCCGCCCCGATTATCCAG
AAAATGGACCAGTACCCGGGGTACATCATGTTCCCACTCTTCCGCGCGCA
CACACGCTACAAGGACGGGAAGTACATCAAGGACCTCAACTACCTCAACC
GTGACCTATCGAAGGTCATAATGCTTGAGACGAATCCAGACGCCTGGTCA
GAAAACCCGAACAACACGATAAAGATGAAACCCTGGGATGGCGACCCAAA
GGACAAAGAATTAATTTCCCTGATCCCGTTCCTAGAATACATCGCCGCAA
TGGGCATATCCGATGTCAGGCCCGTGATCGAGGGATTCGGCAACAAGCAC
GTCCCCACTGAATTCTCCCGGCGTGAGGCGATCGCACGCGCAGAGCACAT
GAAACGTGTAGAGGAGCAACGCAAAACTCGCAAGAGCACTGCCGGAGGCG
CCCTACTCGGCGTACTGGGAATGAGTAGACCGTCCGCCAACGAGGAGAAG
ACGTTCATGGACCTGGCTAGGGAGCGCGGTCTACAAGCTTACCATGAGAT
GCAGAAGCACGTCGAGGATCACAAGGAGGAAATGCTCCAGGAGCAGAAGA
AAATGGAGAAGGAGGCGGCGGAGATGATGAAGACGAGTTTGAGTAAGATC
TTCACTGAGGGCCTACCTAAACCTCCAGGGGCACAATAACCCCCCCCCCC
C

Sequences in the Contig:

SY0AAC2YA10FM1 SY0AAC45YH21FM1 SY0AAD3YF14FM1