Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4305
Length(NT) : 704
Best Gene Model Blast : Link to GSTUMT00005531001 E-value : 6e-93
Numbers of ESTs : 6

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001222070.1| Score: 382 E_value: 3e-35
KEGG Definition: hypothetical protein
Accession: ncr:NCU07382.1 Score: 364 E_value: 2e-33
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG3448 Score: 360 E_value: 3e-35
PFAM Definition: LSM, LSM domain. The LSM domain contains Sm proteins as well as other related LSM (Like Sm) proteins. The U1, U2, U4/U6, and U5 small nuclear ribonucleoprotein particles (snRNPs) involved in pre-mRNA splicing contain seven Sm proteins (B/B', D1, D2, D3, E, F and G) in common, which assemble around the Sm site present in four of the major spliceosomal small nuclear RNAs. The U6 snRNP binds to the LSM (Like Sm) proteins. Sm proteins are also found in archaebacteria, which do not have any splicing apparatus suggesting a more general role for Sm proteins. All Sm proteins contain a common sequence motif in two segments, Sm1 and Sm2, separated by a short variable linker. This family also includes the bacterial Hfq (host factor Q) proteins. Hfq are also RNA-binding proteins, that form hexameric rings..
Pfam Number: pfam01423 Score: 162 E_value: 3e-12
Swissprot: O94408|LSM2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4305
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCGCCAGCGATTATTACAC
CTACTGCTAACTACCACTACCGATACCCGACCGAATATGCTATTCTTCAG
GCATATCCCCCCCTCCTTTCCCTCTTCCTGCCATTTGCCCCACGCCCCAA
CTAATCAACTAACCAACCAACCAACCGATCAACCAACAGCTTCTTCAAAA
CCCTCGTAGACCACGAAGTAACCATCGAGCTAAAGAACGACCTGTCCATC
CGCGGCACGCTCAAATCCGTCGACCAGTTCCTGAACATCAAGCTGGACGA
CATCATGGTCCTCGAGGAGGCCAAGTACCCGCACCTGGCCGCCGTGCGGA
ACGTGTTTATTCGTGGGAGCGTCGTCAGGTACGTGCACTTACCGGCTGGA
GCGGTGGATACGGCACTTTTGGAGGATGCTACGAGAAGAGAGGCTAGCAA
TGCGACGGCGGCAAAAGGGCGGTAGAGGAGATTGTGGGTTTTTTTTTGTA
GTACGATACTGGGTAACTGGTGGATGGATGGATGGATTGGGGGTGGGCTT
GGGAAGTCTGGGTTGATATCATGCCTTGCTTGCTATTATATCTCTCTCCG
GGGCTAGGTTCGCCATATCACGCTCGCTCGAACCATTTGCTTCCGGATTG
GTGCTGTGATTTTTAAACAGCAAGAGTTGGCTACGCGTACTTATTTACAT
GGCT

Sequences in the Contig:

SY0AAA52YK07FM1 SY0AAB29YP10FM1 SY0AAC29YP20FM1
SY0AAC49YI12FM1 SY0AAD25YE12FM1 SY0AAD49YG02FM1