Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4304
Length(NT) : 599
Best Gene Model Blast : Link to GSTUMT00010899001 E-value : 3e-57
Numbers of ESTs : 2

Blast Results:

Nr Definition: 40S ribosomal protein S4
Accession: ref|XP_001545862.1| Score: 276 E_value: 4e-23
KEGG Definition: ribosomal protein YS7
Accession: ncr:NCU02181.1 Score: 273 E_value: 5e-23
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0378 Score: 258 E_value: 2e-23
PFAM Definition: RS4NT, RS4NT (NUC023) domain. This is the N-terminal domain of Ribosomal S4 / S4e proteins. This domain is associated with S4 and KOW domains..
Pfam Number: pfam08071 Score: 144 E_value: 3e-10
Swissprot: Q9P4W9|RS4C_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig4304
TTGGGCCAGACATCACGCCAAACGACAACACACGACAGCAGCAGCAAAGA
GACCCCTCAACAACTCTCCCTAAAGTCTCATAATACAAAAACATGGCTCG
TGGACCGTAAGCCTCCCTCGAAAAAACCCTGGATTTCGTGGTGGGGGGTC
AGGAAGATCACGGGGGGAGGATTGGATCCATCGAGGGGTTTGGCGCAGCA
GATTTCACAGCTCGAGTTTTCGATGTCGAAGCTTCGCCTTTTCGCACTTT
GGATGCTCTCAATTCCCAGATCTACCAGATCCTCCCTCGAATTTCTGCAC
GTGGTGGATATAAAGCTAATTCCCACGTCTACAATAGAAAGAAGCACTTG
AAGAGGCTTAATGCCCCCTCTCATTGGTTGCTCGATAAACTTTCTGGGAA
ATACGCTCCCAGACCTTCCCCTGGTATGTTTCGCTTCACTTGTTGAAGTA
GTCTCCGGGCTCGTCTTTGCTGACGGGTCTTGTCACCAGGCCCCCATAAG
TTGAGGGACTGCATGCCTCTAGTTGTTTTCATTAGAAACAGACTTAAGTA
TGCTCTCAACAGCAGAGAAGTCAAGGCCATCGTAATGCAGCGTCTCGTC

Sequences in the Contig:

SY0AAC29YP10FM1 SY0AAC46YL02FM1