Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4303
Length(NT) : 1151
Best Gene Model Blast : Link to GSTUMT00005108001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001540992.1| Score: 321 E_value: 9e-28
KEGG Definition: predicted protein
Accession: aor:AO090003000852 Score: 282 E_value: 1e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4303
TTGGACTTTCTCTCTCTCCCTCTCCCTCTCACTCTCCCTCTCTCAGTCTC
TCCTCTTTCTCCACTCTCGTTTACAGTGCTTCAGGACATTCCGCCCTCCA
TACTAACGCAGGTGACTTTTTCTTTTCTTTTTTCCCTTTCCCTACTGTTG
CAACCCTATCTCCAAACCTCTCTTTTTTTACTTAGCATACTAGCCTCAAT
CTTAAAGCACCGTTCTCTCACTCTCACTTCCTCTCACTCCATTTCCCATC
TCTTACGCCCCCCTCTGGCTCCACAACTACCACCCTAGTCACTCATTGCC
AGGCCCGTCCTTCAAAACCCTACCACCTCCCAATCCATTTATCAGCAGGC
CTGTCAGACATCGATCCCGCTCAAACTCACAGCAACACGCAAGCAACCTC
CACTCCCACGCTCCCTCTCTCACCTAACCTAAACTCGCATTTCCCGACCG
GACCGTCACGAAGGGGATAGGATCCAGGGATAAAAATAAAACTCTCTATC
ACAACGGGAGAAGGAAGGTAGCTTCTCAAGCGCCTTTAAACGACGAAAGA
AACGGTTGATTAGAAATAAGTCGGGTTAGAATAAATCCGGCTGGGGCTAC
GACGACTTCGCTTTGAAGGTCGGCTCTTCGACATTTCTTTGTTCGTTCAC
TTTTCGGTTCTCGTTAACATTCGATAAAGCCGTCAAAATTCCCTACGACA
GCAGCAGAAATTCCCTCCTCGGAGGTGGACTAATACCCCAGATGCGATCA
AGGATGTTTTACCGACCGACCTCAACGTGGAGCTGGAGTTTCCTCCTTCT
CGCAATCGTTCAATCATGTGTTGTGTTGGGTCTTGAAGGTTTTGTATTCG
CTGCATTCCAGAACAACCTGCATCAGGACTTTATCAACAAATCAAAGAAC
GAGTTTACGAAAGCACAAACACGAACTATCCCGACATATCTGACCCTCTT
CATCTTTGGGCACATTTTCCTTGTCGTTCTTTGCTACGATGCACTTAGAT
TGAAGAACACCATTCAGATCATTGGAATTTGCATCTTCAATGCTGCGTTG
CTTCTCTACGCTGCTATCCAGATGGATCAGATTCACGATGCCAATACTTT
CTTGACCGTTCTTGGCGTTGGACCCGACCCGAACGCTGTGGGTATTAAGG
A

Sequences in the Contig:

SY0AAA33YF21FM1 SY0AAA56YI21FM1 SY0AAA8YL05FM1
SY0AAB15YM15FM1 SY0AAB17YB07FM1 SY0AAB37YN15FM1
SY0AAB58YK12FM1 SY0AAC29YO09FM1 SY0AAD59YG14FM1
SY0AAD9YM04FM1