Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4302
Length(NT) : 810
Best Gene Model Blast : Link to GSTUMT00002002001 E-value : 0.0
Numbers of ESTs : 77

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64287.1| Score: 164 E_value: 8e-10
KEGG Definition: predicted protein
Accession: aor:AO090038000504 Score: 164 E_value: 4e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4302
TTGGCCAACTTTTTTGTACAAAGTTGGCGCCAACTTTCTTTAAATAAAGC
TTCACAGACCCAATACACTCGCTCTTACTAGACACGAAAAGCACCCCAAA
ATGAAGATCTCCCTTACCTGTCTCACATTTCCCCTCATCTCCATCGCCGC
TGCCGCTGTCTTGGGCAAGCGCGACCCGCTCCCTGGGAAATTCACCCTCG
AGGCCAGCAATCAAGGCCTGCCAAACGTGATCTGGACCGAACTCCACTGG
CTCAACGGCTCTGCCTACATCGGAAACAGCAAGTACAACTTCGGCAGCGA
GAAGCTAGAATTCACGAGCGGCGGTGACGGGCTATCCTTTACCTCTTTCC
ATTCGTCTCCCACCGGATGGACCGACTTTTACATCTTTCCGAGTGAAAGT
CGTGCCGTGGGGTTTACCATCCCGCACAGCGCGTTAGTGCCTCCCGGGGC
GTCTACTAGGGGGTTTGAGAATGTTGGGGGACAATTTGCGTATCAGGGGA
GGATGGAATGGCAGGCTTGTGATCAGGGTGATGGGGTTTACCAGATTTAT
TGGGATGGTGCATCGTCGGCTAGATGCGTGCCTGTTGGATTGTACATCAA
GCCGAGTGCTTGTTAGAACGGGTGACGTGGGCACTTTGTCTTATTATTTG
ACTATTATGGCGGCAATTAGGGCTAGGATGGATGGACATTAACTGTCGTC
GTGAATAACTGCTGTTTAATGGGATTGGTTGTGGGTTTTCATAAATTGAA
TGGGGATAGAGATGGAATTGCACACATTCAGGGCCATTGCTGGGTCCAAG
GTTCTAAATT

Sequences in the Contig:

SY0AAA38YJ19FM1 SY0AAA47YA18FM1 SY0AAC1YI02FM1
SY0AAC21YE22FM1 SY0AAC25YO24FM1 SY0AAC27YD04FM1
SY0AAC28YE20FM1 SY0AAC29YN20FM1 SY0AAC30YN21FM1
SY0AAC30YP13FM1 SY0AAC36YB19FM1 SY0AAC38YB19FM1
SY0AAC41YB10FM1 SY0AAC41YK13FM1 SY0AAC42YF11FM1
SY0AAC45YE07FM1 SY0AAC47YA18FM1 SY0AAC49YA10FM1
SY0AAC50YJ23FM1 SY0AAC51YM19FM1 SY0AAC51YP03FM1
SY0AAC56YD22FM1 SY0AAC58YN06FM1 SY0AAC9YG09FM1
SY0AAC9YN23FM1 SY0AAD11YH17FM1 SY0AAD11YK10FM1
SY0AAD13YP05FM1 SY0AAD14YC14FM1 SY0AAD14YK02FM1
SY0AAD15YI16FM1 SY0AAD16YG01FM1 SY0AAD16YM10FM1
SY0AAD18YD10FM1 SY0AAD19YN14FM1 SY0AAD1YC02FM1
SY0AAD20YI08FM1 SY0AAD21YG17FM1 SY0AAD34YB17FM1
SY0AAD34YN05FM1 SY0AAD35YJ08FM1 SY0AAD3YD19FM1
SY0AAD40YF20FM1 SY0AAD40YM06FM1 SY0AAD41YJ23FM1
SY0AAD42YI08FM1 SY0AAD43YD17FM1 SY0AAD43YK14FM1
SY0AAD44YD08FM1 SY0AAD46YH16FM1 SY0AAD46YI10FM1
SY0AAD46YK20FM1 SY0AAD46YK22FM1 SY0AAD47YB19FM1
SY0AAD47YF05FM1 SY0AAD47YK07FM1 SY0AAD48YI23FM1
SY0AAD48YO11FM1 SY0AAD48YP15FM1 SY0AAD49YA23FM1
SY0AAD50YC10FM1 SY0AAD52YD01FM1 SY0AAD52YK18FM1
SY0AAD52YM03FM1 SY0AAD53YB17FM1 SY0AAD53YG12FM1
SY0AAD56YM23FM1 SY0AAD57YP02FM1 SY0AAD59YO10FM1
SY0AAD5YC14FM1 SY0AAD63YD05FM1 SY0AAD6YA12FM1
SY0AAD6YH10FM1 SY0AAD7YM09FM1 SY0AAD8YL09FM1
SY0AAD9YO17FM1 SY0AAD9YP19FM1