Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4301
Length(NT) : 754
Best Gene Model Blast : Link to GSTUMT00011247001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4301
TTGGCTACGCCCCTCGTGGTAATCTGACGAATCTTTCTCGTCCTCCTCCC
TTCCCTTTTATTCCGCTTTCTCTCTCCTCCTTTCCTCTCCTCCCCCATCT
CCCCCCTCCAACCCTTCATTTCCTTCGCCAAGATCACCTAACCTACCGCT
ATTGCTGACTCGACTTCTCTTGACAACGAGTGGCCACTGATTGCTGGTGT
TCCACACTTCTCGCGGCGTACCTAGCCCGTCCTTCACCCAGCCGGGCAAC
GACGCTCTAGTAAACGCTCTTCCATTTACGCCCCCAAACCCTTCACCGCT
GCCACCGAACAGGATGCCGGCCCGTGCAGTTTTCATCGCCGTGTCGGCAG
CTATAGCTGCTGGCATCGTGGTTTACCATGAACGCGAGAGACTCCTGGAA
CTTCTCGACCGCACTAGTCGGAAAGTTGCCTTATCGCTCTCACAGATTGC
GGAAGACTTCAACCCACGACCACGACAAACGGAGCATCCCATGACCAGTA
GGGCACCCCCTCGACCGCGAACTCCGAGCGAGGAACAGTGGACAGAGGAG
GAGAAAGCTTTCATCTTTGACGAGAAGCCTACCGATACCGAGGCACGCAA
GCGAGACGAGGACACTTTCGGCGCTGCCTCTGGCTGGGAGGGACGAGATG
GCGCGGCTAGAGACGTAAGACGCCGTGGTTCTCCACTCGCCGCTCCGGCA
GACGGTTCCGTCCTTTTCGACACTGCACCGGCTTCGCCTGCCGGGTCCTC
CACC

Sequences in the Contig:

SY0AAA50YD22FM1 SY0AAB20YP04FM1 SY0AAC14YN09FM1
SY0AAC15YB07FM1 SY0AAC29YN17FM1 SY0AAD22YA15FM1
SY0AAD26YK16FM1 SY0AAD63YK01FM1