Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4300
Length(NT) : 1053
Best Gene Model Blast : Link to GSTUMT00007201001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: Bax Inhibitor family protein
Accession: ref|XP_749457.1| Score: 720 E_value: 4e-74
KEGG Definition: Bax Inhibitor family protein
Accession: afm:AFUA_2G03220 Score: 720 E_value: 2e-74
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1630 Score: 332 E_value: 9e-32
PFAM Definition: UPF0005, Uncharacterised protein family UPF0005. The Pfam entry finds members not in the Prosite definition..
Pfam Number: pfam01027 Score: 144 E_value: 5e-10
Swissprot: Q5XIA8|GHITM_RAT

Sequence:
>Contig4300
TTGGCTTTCACCCTATCCGCAAATCAAGTACAAACAGCAAAATAACAATG
TTTCTTCAGACCACCATCCGCCCCTTTGCAGGAAGGACTCTCTTCCGCTC
TTCGACGAAACCATCCACTCGTACCTTCACAGCCCTCCGTTCGCCCATCC
TCCGACAGGCAATCACCCCCGTCCGCCACCAACTCCCAAAGACCCAGTTT
GCCACAAAACGTTTCTTCACGGCAGATCCAGCGGTCGTCGCTCGTCCGAC
TAGGCAGCAGAGTATTTAAAAGCTCTTGTATGCAGGCGGAGTATTTGGCG
GCACCCTTTTATCGATCAATCTTTTGTTCAACCATGAAACCCGCCAGGGC
ACCATTCCACTATATGAGCGTGCCTATCTGCAGGAAACGTTCACTTACAC
TGGTCTCGGGGTCGGTATGATAGGTCTAGCGGCGAAGGGCCTGCACAATA
TGGGGTGGAGCTACCGGCTTATGAGCATGAACCCATGGCTCATCATCGGT
GGCGGCCTTGCTGCGTCAGTGGGGACAATGTTCGCCACTAGGGTTACAGA
TCCAGACAAGTAGTTCCTCCCTCCCCCTTCCTTACTTCCCTCCCTCCCCC
TCCGCATTAACAAAACTAGCTACATCCAAAAACACATCCTTTGGTCCGCC
TTCAACCTCACCAACGCCGCTGTCCTCGCCCCCCTCTTCTTCTACAGCCC
GGCCATCCTTGCCCGCGCGGGCCTGTACACCGTTGGCATAATCGGTTCAA
TATCATTCGTCGGCGCCACGGCCAAGGAGGACAAATACCTCTACCTCGGC
GGCCCGCTCCTCGCCGGTGTGGCTGTCGTGGCACTCTCCAGCCTTGCGCC
CTTGGTCCTGCCCCTCGGCTCCCGAGCCCTGATGGCGTCAGAGTCTATCT
CCGTGTACGGTGGGCTCGCTGTGTTTGGTGGGCTCACGCTGTACGACGTG
CAGAAGATCATGAATAATGCGCGATTGGCGGAGCAGGGCCTCATCAAGAG
GGATACGGTCAATGAGAGTATTAGCCTTGAGTTGGACTTTATCAATATTT
TCA

Sequences in the Contig:

SY0AAA18YC07FM1 SY0AAC29YN11FM1 SY0AAD32YN10FM1