Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig430
Length(NT) : 1558
Best Gene Model Blast : Link to GSTUMT00001829001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein An07g09710
Accession: ref|XP_001392045.1| Score: 706 E_value: 3e-72
KEGG Definition: hypothetical protein
Accession: ang:An07g09710 Score: 706 E_value: 1e-72
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1916 Score: 190 E_value: 5e-15
PFAM Definition: No Hit Found

Sequence:
>Contig430
TTGGGCCGACAAAGTGGCTGACCTTCAGTTTGGGGCAACCCAAGGACTGA
AGTCGGCTCCTCCTGAGAACGCGCCCAAGGGCCCCGCAAAGTCGAGAAGC
GTTAGTCCTGGTGCCAGAGCCCCCGATCAGGGTGAGGAAAAGCCGGCGGT
TCATAATGGCAACACCAAGCGCAAGAGAAAGGACAAGGGTAACACACAGC
AGTCAGGCCCGTCGGGTCCGTCCGACGAGAAATCGGATAAGACCGTTTTG
GCCCCTATCAAGCCTAGGGGAACTTTAGCGACAGTTCAGGGCGGAGATCA
TGAGACTATCGCTGGTCTTTCGCCCGCACTCTTGGACCGTGAGATCAAGA
AATTTGAGAAGTCCGTGTCCTCTGAGCTTGCCAAGACGTTAAACAAGGAG
ATCACAGATTTGTATCGCCGCATTGATGAAGATAAGAGGATTCAACAAGC
TGCTGGTGATGCTAAGCAAGATGCTATCCTTAGACTTCTGTCCAGCACTC
TTACGGATAACGTTGAACAGGTCATTGGGCGCATCGTCATGACCAACATC
CAGCAGTCTGTCCTGCCTGCCATCTCGAGTGTTACCAGTGCGGCTGTTGA
GAGGAAGCTTGGGGAAAGCGTTTCGAGGTCTTTAGCGGCTACTCTTCCTG
CTGAGCTTCATGCCATTGTTCCAGAGGCCGTGAAGAAGATATTCGGCCAG
CCTGAGTTTATGGCCAGGATTGGCGAAGCCATTTCTAGGCCGTTGGCTTA
CTCTATGGAGCAGGAAATTTCCAAAACCATCTGCCGCTCTCTCCTCCCCG
CTTTCAAGCAGCTCTCGGACGAAACCACCAGTAAGCTTGTTGCCGATTTC
GACAGGAAACATAATGAGACGATTCAAGCTTTGGAGCGCGTACATGTTCA
GGATACCCAGAGGATTGATCAGCTCACCAATACTGTCAAGAGCCTCGTCG
ATGTTGTCCAGGCCATGGCTAAGTCACAGGCAGAGTTCCAGGACCAGGTG
CAAAGGGCCCAAGCAGAGTACGTTCAGGCTTATGAGCAGACTGGAGAACC
AGAACCGGCGCCTAGGGCCCCTACTCCCCCTCCGCCCCCCACTCCGGACC
AGCTGGAGGCGGAAGAGACTGAGAGATTCTTGAGGAATGGAAGATACGAG
GAGGGCACTATCAAGTGGCTTCAATCGAAAGAGCGTCAAGCGGAATTGTT
CGATGAAGTGGTCGTCCGATACAGATACGATTTCCTTCCAAACCTTAGCC
AGCTTGTTCTCTTGTCGGTCTCTGCCGCTGTCAGCATCAAGTTTGAGAAC
AAGGTTTATGAGCGACTGAGCTGGCTTGAAGGTGTTCTTGCAGTTCTAGA
TCCTATGGACCCCGAAATCCACGAGATTTGTCACAGAATCATGGCGGTTG
TTGTCCAACGACTGGAGCAGTTGTATATGAGCACTGCTGAGAATAATATG
GCCGATCCCATCCTTCGCAAAATTCCACCGATCGCTCGTCGAGCTAGGGA
GCTGTCTTCCATGGCTGCTTAGATGAAGTCTGCTGCGCTTGATAATTCCC
CTTTTCCA

Sequences in the Contig:

SY0AAA23YO17FM1 SY0AAB12YG06FM1 SY0AAB56YN23FM1
SY0AAC48YD03FM1 SY0AAC50YE17FM1