Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig43
Length(NT) : 673
Best Gene Model Blast : Link to GSTUMT00003183001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_505371.1| Score: 212 E_value: 2e-15
KEGG Definition: hypothetical protein
Accession: yli:YALI0F13387g Score: 212 E_value: 8e-16
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 129 E_value: 2e-08
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 125 E_value: 5e-08
Swissprot: O94587|COX18_SCHPO
Gene Ontology:
GO:0031305 = Cellular component: integral to mitochondrial inner membrane
GO:0008565 = Molecular function: protein transporter activity
GO:0006119 = Biological process: oxidative phosphorylation
GO:0051204 = Biological process: protein insertion into mitochondrial membrane
GO:0008535 = Biological process: respiratory chain complex IV assembly

Sequence:
>Contig43
TTGGCCCCTTTATCGTGTCCTCCTCACAAAACCCCTTCACCACCGCCAAT
TCTCAAGCACCACCCCAAACCACCTAATACCCGCAATCCTCTCCACAACC
CACGACCTCCTAACAACCCTCCACACGAGCACGCACCTTCCCTACCACAC
CCTGATCCCCCTCTCGGCAATCTTCCTCCGCCTAACCATAACAACCCCGC
TAACGATATACTCCCGACGCCGCGCCCTCCGCACCCAACGTCTCCAACCG
ATCCTAAGCGCGTACCAGCACCCCATCGCCAGGGGTGCAAAGAGTGCTAC
TACCACGCCGCAGGCGTGGGAATTAAAGACTCGCAAGGAAATGCGCGAGA
AGAGAAGGGAGCTGTGGAAGAGGTGGGGATGTCAGGCTTGGAAGATGCTG
TTGGCTCCTGTCGTGCAAATTCCAGTTTGGGTCGCAGCGAGCATGACGTT
GAGGGGGATGACCGGGATTGAAGGGTTGCCAACCTGGCTGAGGGGATCGG
GAGAGATTGGTGGGGAAGCGTGGGTGGAGGAGGCGTTGGCGACGGAGGGC
GCACTGTGGTTTGGGGATTTGCTGATTGCGGATCCGTACTTGGCCTTGCC
AATGGGGTTCTCGTTCTTGCTGTTTGCGAATATTGAGCTACAATCGAAAC
TGCACCCTCCAAGTACGCGGAAG

Sequences in the Contig:

SY0AAA11YJ11FM1 SY0AAB48YK04FM1