Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4299
Length(NT) : 1201
Best Gene Model Blast : Link to GSTUMT00009172001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_13751
Accession: ref|XP_001547672.1| Score: 611 E_value: 2e-61
KEGG Definition: hypothetical protein
Accession: mgr:MGG_12309 Score: 534 E_value: 9e-53
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG2000 Score: 147 E_value: 3e-10
PFAM Definition: Spc97_Spc98, Spc97 / Spc98 family. The spindle pole body (SPB) functions as the microtubule-organising centre in yeast. Members of this family are spindle pole body (SBP) components such as Spc97 and Spc98 that form a complex with gamma-tubulin..
Pfam Number: pfam04130 Score: 213 E_value: 7e-18

Sequence:
>Contig4299
TGCATTTAGAGCTATTCTTAGCTGGTATGCAGGTAAAGGGACAAATATCA
ATGTTATCCGCACCTTCGCACGATCCAAAACCTCCACCACGAACTTTCCC
GAGCGCCAAACCTTCGTCGCATCTGTTTGTGATAAGCTTGCCATCCTCGA
TCAGCACTTAATCAAGCTGGAGGAGCTTCTATTGGTGGGGAGTAAAGGCT
TAGATCAAATAGTCTCGTTGCTGGCGCTCCAGGGCGAACTAGAACCCTTT
CTCACTCCCTTTGACCTCCTCTCGGATATCATAGCCAAACTTCCCCAGAC
AGGAAAGCCTCCAGCTGATCTGGCACTACAGCACTTAGAAAGCCTCTTCC
AGCTAGCGTGTAGGCTACAGTCCACGGGCGACCAAAAATCTTTCAAGTTT
ATAATGGACATATTTTTCAGCTGTCTGCAAACGTATTTGCGCCCTATCCA
TCAATGGATGGAATCCGGCGAACTCCGCAAAGATGACGAAGTATTTCTTA
TATCTAAAACCCGCAGCGATGAGGAGGTCGAACTAGGAGGTCTATGGAGC
GATCAGTATTCCCTGAGAAAGGATGTGTCCGGAGTGCTAAAGGCACCTGA
ATTCGTCCACGCAGCCGCAGCGAGAATATTTATCACCGGCAAAAGTGTCG
TTTTCCTAAAACGGCTTCTAGAACACGGTATACCAAGTTCTGCCCTCCCA
CTCCAACCACAGCCTGTCAACAGAATAGACGTCAACCTCTCTACAGCTTG
CAAGAGCGGCGAGTACCTCGCACCCTTTTCGGATATGTTCGCCGCAGCAT
TCGACAAATGGATAAACGACCGTCACCATTCAGTCTCCTCTCGCCTGAGA
GATATATTATACCAGGACTGCGGTCTATGGAAGAGCTTAGATGCAATTGA
GCACATATATCTTTGTAAAAATGGTCATCTCTTTGACACGCTCTCACAGG
CGATGTTTGAAAAAGTTGATAAGGGTGTGCAGACATGGGGGGATCGGTTC
CTGCTCACGGAGTTACTGCAGGGGATATACGGGGGTGTCGGATGTGTGGA
GGTCGGCAGGATGAGGATGAGGGCTAAACCGGAAAGCACAAAATCCCTTC
GAGAAAGAAGAAGGACTGTCAAGATGTGGAAGAGCCTTGAATTGAGTTAC
GCTGTATTCTTCCCAATCTTGCTCCTTTGGTGATCCAGTACTGACCGAGT
A

Sequences in the Contig:

SY0AAC29YN10FM1 SY0AAD4YB10FM1