Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4298
Length(NT) : 2030
Best Gene Model Blast : Link to GSTUMT00000583001 E-value : 0.0
Numbers of ESTs : 65

Blast Results:

Nr Definition: hypothetical protein AN3674.2
Accession: ref|XP_661278.1| Score: 304 E_value: 2e-25
KEGG Definition: hypothetical protein
Accession: ani:AN3674.2 Score: 304 E_value: 8e-26
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG3592 Score: 165 E_value: 4e-12
PFAM Definition: CDC27, DNA polymerase subunit Cdc27. This protein forms the C subunit of DNA polymerase delta. It carries the essential residues for binding to the Pol1 subunit of polymerase alpha, from residues 293-332, which are characterised by the motif D--G--VT, referred to as the DPIM motif. The first 160 residues of the protein form the minimal domain for binding to the B subunit, Cdc1, of polymerase delta, the final 10 C-terminal residues, 362-372, being the DNA sliding clamp, PCNA, binding motif..
Pfam Number: pfam09507 Score: 137 E_value: 9e-09

Sequence:
>Contig4298
TTGGGCGCTTCCTTCTCTTCCCCCTTCTCTCTCCTTCCCTCCTCTGCTCC
TCGTCCACACTTTGGCGTCAACACCACATTCTCCCTTTCTTCAGACCACC
CCCCCTTACTTACCTTTTCACTTCCTCGTGTGCTCTTACTCACCCCACCC
ACACAAGCTGCCCTTTGTTAGGATAACAATAGGCTCTTTTTCTTCTTAAA
TTTCTTGAGAAAACTCGTTCTCTTCTACACTAATAATGTCCGACGCTGTC
AAGCCGGAGGATACCAAGCCCGTGGCAGTCGAACCATCCAAGTCAACTGA
GACCGAAGGGACTGCTGCCGCCTCGGAGACTGTCACCGCACCTGCCACCA
CTTCTGATGAGGTTACTCCTGTAGCTGCTGACAAGCCCGTTGAGGAGACC
GCTGCTGTTGAGGAAAAGAAGGAGGAAAAGAAGGAGGATGACAAGCCTCC
CGAGCCGAAGGAAATTACACAGGGAACTCTATCCAGGTTTCCCTCCGGTC
TCATGGCCTTCTTTAAGACCAAGAGGTTCTTTTACTTCCAGGACGAGCCG
ATTCCAGAGGAGAGGCTGAAGGTTTATCTTCAGAAAGCCAACTCTACCCA
TACAACTGCTGCTTATGCCAGTCAGACAGGAAAGGGGTTGCTCCTTTACT
CTAAGGCTGAAGGACAGAGTCCTCATGGTATCATCAAACTAGCAGATGTT
ACTGAGGTCACCTCTCTTGGTGCTGCCAAATTTGTTTTAAAGATTCCGCA
CGGTAATGATCTTCACTTCGAGTCACCAGGTGAGCGTGATAGCTGGGTTT
TCACCCTTAAACACAAGATCACCGAGGCCAAGGCTATCGAGGAAGAGATT
GTCAGCTCCGAGGGCTACAAGTCTACCCTTGCGAGACTGTCTAAGTCTAC
TCCAATTGCAGCTGCTAAGGCGCCGGAGAAGCCTGTTGAGACCAAGGAAG
AGAAGGAGACTGGAGAGTCTAAGCCTGAGGAGGACGCTGAGAAGGTGAAG
TCCACCGAGACGGTTCCCGCCGTCACTTCTGATGATGAGGCTGGCCCATC
TGATAAGAAGGATGATGTCAAGCGCTCTGCATCAAAGGGCAAGAAGCGAG
TATCTGTTTTTGGATTCCTCAAGAAGGAGAGGGTTGAAGAGAAGAAGGGA
GAGTCTGCTGAGAAGGATGAGCCTAAGGAGGAATCAAATGTTGCGGAGCC
AACAGCAGCTACCACTGATGCGCCTGTTGATGCCACAGTTGGTGCTGAGG
TGAAGGAAACCGAAGCCGTTAAGCCTGTTGAGGGGACCAAGGAGGTTGAG
AAGGCCCCTGAGGTGCCTAAGCCTGTTAAGCGACATTCTTACTTCACCGT
CAACCCTTTCAACCGCGAGAAGAAGGAGAAGGAGGTTGCTGAGGACAAGA
AGGAGGGAGGGGCTACTGAGCACAAGACGGAGACTGAGACTGCACCCACT
GAGGCGAAGCCCATAGATGTCGCTCCTGAAGCTTCAACCGCTACCGGGGA
ATCCAGTGCCTCTCCACCAAAGCACAGATTCTACACTAACATCTTCGACA
GGAGGGGCGACAAGACAGAGAAGGAGACTGAGACTAAGCCTGCTGATCCT
GTTACTGAACCTGCCGCTGTGCCAGCAACCACCACTGGGTCTACCACTAC
ACCCGGTGAGGAATCAACTGTTGCTGAGGCTACTAGCCCTACGACCGGCC
CTAGGGAGCAGAAGCGCAAATCAAGCTTCTTCTCTCCTTTCAAGAAGGAG
AAGAGGGCCGATGATGTCAAGTCGGATACTGAGGAGGGCGAACCTTCTTC
TCCCAAACCTAGCACGTCTCCGGTTCCCAAGCCAGGTTTGTTGACTGGTC
TCATGCGCAGAGCTAGCAAGGCTGGTAAGGGAAAGGAGACTGAACCCGGA
GAGGTTACCGCGCCCGCTACTGTCGTTGAGGAGACTACTCCTGCTGCCCC
TGTAACTACCACAGAAACAGAGACACCAAATGGTGCTCCAGCTACTGCCG
AGACTAATGCCATTGGTGACGTTGTTCCGG

Sequences in the Contig:

SY0AAA10YG23FM1 SY0AAA15YO09FM1 SY0AAA19YM18FM1
SY0AAA24YC01FM1 SY0AAA24YC01FM2 SY0AAA35YN01FM1
SY0AAA38YB16FM1 SY0AAA48YE13FM1 SY0AAA48YI04FM1
SY0AAA49YJ08FM1 SY0AAA52YN12FM1 SY0AAA55YA18FM1
SY0AAA61YD17FM1 SY0AAA6YG05FM1 SY0AAA8YJ18FM1
SY0AAB47YK05FM1 SY0AAB4YO18FM1 SY0AAB51YB09FM1
SY0AAC12YO15FM1 SY0AAC14YF22FM1 SY0AAC14YK07FM1
SY0AAC23YF16FM1 SY0AAC24YK05FM1 SY0AAC27YK03FM1
SY0AAC28YC02FM1 SY0AAC28YK11FM1 SY0AAC29YM21FM1
SY0AAC31YN02FM1 SY0AAC32YM09FM1 SY0AAC33YH02FM1
SY0AAC36YO01FM1 SY0AAC39YA22FM1 SY0AAC42YJ04FM1
SY0AAC44YB18FM1 SY0AAC44YK21FM1 SY0AAC45YD17FM1
SY0AAC46YA17FM1 SY0AAC46YJ05FM1 SY0AAC47YD18FM1
SY0AAC48YM17FM1 SY0AAC48YM21FM1 SY0AAC53YK08FM1
SY0AAC54YD18FM1 SY0AAC58YE18FM1 SY0AAC58YK11FM1
SY0AAC62YO02FM1 SY0AAC7YC04FM1 SY0AAD10YJ02FM1
SY0AAD12YK14FM1 SY0AAD30YI11FM1 SY0AAD32YE23FM1
SY0AAD3YG10FM1 SY0AAD3YN12FM1 SY0AAD41YO09FM1
SY0AAD46YI14FM1 SY0AAD48YM09FM1 SY0AAD48YM23FM1
SY0AAD53YF23FM1 SY0AAD55YE14FM1 SY0AAD57YJ13FM1
SY0AAD5YG15FM1 SY0AAD60YL06FM1 SY0AAD62YB11FM1
SY0AAD6YD16FM1 SY0AAD9YH20FM1