Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4296
Length(NT) : 1129
Best Gene Model Blast : Link to GSTUMT00011408001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: Ankyrin
Accession: ref|YP_920685.1| Score: 400 E_value: 6e-37
KEGG Definition: ankyrin
Accession: tpe:Tpen_1284 Score: 400 E_value: 3e-37
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 301 E_value: 4e-28
PFAM Definition: Ank, Ankyrin repeat. There is no clear separation between noise and signal on the HMM search Ankyrin repeats generally consist of a beta, alpha, alpha, beta order of secondary structures. The repeats associate to form a higher order structure..
Pfam Number: pfam00023 Score: 117 E_value: 9e-07
Swissprot: Q12955|ANK3_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0006605 = Biological process: protein targeting

Sequence:
>Contig4296
TTGGCTGCCCCTTGAACCCTCCTTTTCTCGGTGGCAGTACTCAAGTGCAT
TTCCTGTCCTACCTTCACCCCCCGAAGTAGGGGGAAAGAAGCTACGTGAA
GCGAAACCGGGGTCCAACAACGATAATCACGGGGGTGACGGCGGCAAACC
CAAAACTCCTCTCGACATACCCACGATCCGGGATGAAGAAAAAGGCATTC
GACCCGCCCAAGATCATGCCATTGCTCGACTTCCCGAACGAGCTCATACT
CCTGATAGCCGAGAGCCTCCTGGACGTTAAGTCCCTCTCCGCCCTGATCT
TAACGAATAGACGCCTATCCTCCCTCCTAACGCCACACCTACACCACAGA
GCAAGCGAGGACAAGGACGGCATCCCAGCGCTCCTATGGGCCGCCTGGCG
CGGCCACGGACCCCTCGTCCGCCTACTCCTAGACATGGGCGCGGACATCG
ACATGACGCACTCGGAGGATAAGAAGACAGCGTTGCACAAAGCCGTCTGG
TACGAACACCTCGACGTCCTGCGCGTCCTCCTGGACAGGGGCGCCGACGT
ACACGCGCGGGCAACGCACGGCTACACAGTACTCCACCTCGTCGCCATCG
GAACGCGTAATTCCTCCGAAGCGATAGCCCGTCTCCTCCTGGACCGGGGA
GCGGACCCGGACGTGCAGAACGAGCACAAGGTCACGCCGCTGCACCTCGC
CGTGCAGCAGACGAGCACAAACCTCGTCGCCATTGCAAGGCTCTTCCTGG
AGAAGGGCGCCAAGCGTAATCCACGGAATGGGTCGGGGGATACGCCCCTG
CACCACGCCACTCGCTTCGGCAGGAAGGAGATGGTTCGGTTGCTGTTGGG
TAGTGGCGCGGATGTCAATGCCCTTGATTACTTTGGCGATACGGCCTTGC
ACATTGCCATCGAGCGACATAATGAGCCCTGCGCTAGGATCTTGCTCGAG
TACGGTGCTGACCCTTACGTCAAGGATAGCTCCGGAAACACCGTGTGGGA
TTGGGTGCACTCGGGCGCTATGTGGGAGAGTCAGGAGGATGTAATTATGG
CGGAGAGGTTAGCCGACATGATGGGGAAGATGTGCTTTGGCAAAGGCTCG
CAAGGGAGGAGGTGTGAGCGTGAGCGTGA

Sequences in the Contig:

SY0AAB43YM12FM1 SY0AAB57YE08FM1 SY0AAC29YM15FM1
SY0AAD60YE24FM1