Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4295
Length(NT) : 742
Best Gene Model Blast : Link to GSTUMT00005843001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein ATEG_02543
Accession: ref|XP_001211721.1| Score: 1075 E_value: 1e-115
KEGG Definition: hypothetical protein ( (AL513464) probable SEC23 [Neurospora crassa OR74A] )
Accession: ncr:NCU01318.1 Score: 1069 E_value: 1e-115
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1986 Score: 903 E_value: 3e-98
PFAM Definition: Sec23_helical, Sec23/Sec24 helical domain. COPII-coated vesicles carry proteins from the endoplasmic reticulum to the Golgi complex. This vesicular transport can be reconstituted by using three cytosolic components containing five proteins: the small GTPase Sar1p, the Sec23p/24p complex, and the Sec13p/Sec31p complex. This domain is composed of five alpha helices..
Pfam Number: pfam04815 Score: 309 E_value: 3e-29
Swissprot: Q0CUU1|SEC23_ASPTN
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>Contig4295
TTGGATGATCCTTACCGATAGTTTTACATCCTCTATGTTCAGGCAGAGTT
TTGTCAAGATTTTCGATAAGGATACCGCCGACAATCTCCTGATGGGCTTT
AATGCTTCGTTGGAGGTTTTGACTACTAAGGAATTGAAGGTCACTGGTTT
GATTGGTCATGCAGTTTCGATGAACAAGAAGTCAACCTCCGTTGGTGAGA
CTGAATGTGGTATTGGTAATACCTGCTCTTGGAAGATGTGTGGACTCAGT
CCCACAACCTCAGTCGCGACCTACTTTGAGATTGCCTCCCAAGCAGGCCC
TGCTCAACAGCAACAAGGGCCCCAGAAGGGTCTTATTCAATATCTGACCT
ATTATCAACACTCTTCCGGCCAATTCCATCTAAGAGTTACAACCATTGGT
CGTGATCTTAGCGGCCCCACTGGTGATCCGTCGATTGCCCACTCCTTTGA
TCAGGAAACTGCGGCTGTGCTCATGGCCAGAATTGCTGTCTTCAAGGCAG
AGGTCGATGACGGTCCGGACGTGTTGAGATGGGTTGATCGAATGCTTATC
AGATTGTGCTCGAGGTTTGCAGACTACCGCAAGGATGATCCTACATCATT
CAGACTAGAGAAGAACTTCACTTTGTACCCACAATTTGTCTTCCACCTGC
GTCGTAGTCAATTTTTGCAGGTCTTCAACAACTCCCCTGACGAAACAGCT
TTCTACCGGCATGTCATTAATCGCGAAGATGTTGGAAACTCT

Sequences in the Contig:

SY0AAA31YE04FM1 SY0AAC21YA06FM1 SY0AAC29YK22FM1