Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4294
Length(NT) : 3407
Best Gene Model Blast : Link to GSTUMT00001773001 E-value : 0.0
Numbers of ESTs : 19

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001538356.1| Score: 484 E_value: 4e-46
KEGG Definition: hypothetical protein
Accession: ani:AN6228.2 Score: 476 E_value: 2e-45
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3598 Score: 173 E_value: 9e-13
PFAM Definition: GYF, GYF domain. The GYF domain is named because of the presence of Gly-Tyr-Phe residues. The GYF domain is a proline-binding domain in CD2-binding protein..
Pfam Number: pfam02213 Score: 171 E_value: 2e-12
Swissprot: Q5U236|PERQ2_XENLA

Sequence:
>Contig4294
TTGGCAGAATTTGCAATTGAATCAGCAGGGCCACTTCCCGCTACATGGGC
GATCAAGGGAGGGCAGTATTGGCGGGATCATTGGCGGTCTGCATGAGTAT
GAGCCATTAAGTCCTACCGAAACTAACCCTTATCAGAGCCCTGCACCCGA
AAAGGCGGACGATGATGATATGCCAGAAAATGGCGGCGGGGGAGGTATTA
TTGGAGGATTTAGAAGAGGTGATGTGGGTGCTCCTGGTAGCGATAGAAGC
GGCCGAAGCTCTACTGCCGGGCTGGGTAGTGGTATCGGTAGTGGTCTTGC
GTCATTCAGTTCCCTGGGTGGTGGCACTTTGTGGGGAGGGACCTCTGGGC
CTTCTGGGCTTGGAAGCAATACCGCCCCGAGTTCATTTTTTGGTAGTGGC
GGTATGCTCGGCGATTTGAACGGTCCCAACACCATTGGCAGTGGAGGCTC
GTTTTCTGGCGGTGGAATCGGTGGCATGGGAAGTATTGGAGGTGGAGGGT
ACGGATCGGCAAGCCGTGCAAGCCGGCTTGGACAGCTGTTCCAGCAAGAG
CCACAAGTAGAGGAAGAGCAACAACCGCAGCAACTGCAACAAGTTGGTTT
TGAGTCGAATGACGCTTTCGGTGATCTGAGGTTCGGTAATGCGTTCGGCA
GCGGTAGAAATGGGTTCGGTAGTGCCACTGATAGCCCCATGAGAGAGAGG
CCGGGAGTCATGGACATTTTTAACCTGCATACCACGCGGAGTGTTGGCAA
TCTGGCGGCTGCTTCTGGAGAAAATACCTTGTACCCTAGGGAACGTGATG
ACCCATTACCCGGTATCCATAGTCTTCACCAGAATCAACCGGCTCAACCA
GCACCACTTTCTGCCGGTATCCAACCGCCGGCTGTTCAACAACCCCCACA
GATTCGTCCTCCCCCTGGGACCGTCGCACCACAACAACACGTAATGGTCA
TGCCGGACAAGATACAGTGGACCTATCGCGATCCTAGTGGGACTGTCCAG
GGTCCTTTCTCTGGCTTAGAGATGCATGATTGGTACAAGACTGGGTTCTT
CACCCAGGATTTAGCTGTAAAGAGGGTGGAAGATCCAGAGTTTGAGCAAT
TGGGTAATCTGGTGCGCAGAATAGGGAACACACGCGAGCCTTTCCTAGTC
CCGCTTCAAGCTCCAGCAAATTCTGCTCTTGTGCAACCCACCACATCTCA
ACCTAACACTTGGCCTGGAGTCGCCGTCTCCTCTTCCTGGTTGAATGAGA
ACCAACAGCCTCAAACTGGCGGCACAGTTCAACCTCCGTTTGCTGGGAGT
TTCCCGAGTTTCGGAACGACCCTCACTGCTGACCAACAAAATGCGCTGGA
GAGAAGGAAGCAGGAGGAGCAGTACCTTTTGGCTAGGCAGCGAGAGTATC
TGGTTCAGCAACAAGTTTTTGCAAAAGCACACGCTCTGCATCACCAACAC
TCGCAACAAAGTCTCCATTCTCAACCCAGCTTTGGGAGCTTACAAGGAAG
CCTGCAAAGCCCTGGTGGGTTCGCCACTCCTGTTACTACAACAACCGTCG
GGATTGGTGGACAGAACTCATTCGAGCCGGGCGTATTATTAAGGCAGGCC
GGTGCGGCCGCCGGGAGCGCTGATGCTTTTGGAGTTAGCGGCGGACATGG
CATGCCCGGTATGGCCGGGCAGCAGCTCCAACAGAATAGCCAATTCACTC
AGCAGCAGCAACATGTTCAGGCCGACCGCTTACAGATGGAACAGAGGATC
CTTGAAATGCAACGTCAACAGGCCCAGAAGGCATACCAAACACAGCATCA
GCAAGTTGAGAAACGGCAAGAACTTCAACAGGCTCAGCAACAAGCAGTGG
CGGCTGTCGCACAAGCCCAACAGCACCAATCTTACGGGGTTCACCACGAG
AGGGAAGATGAGAGATTCCCACAGCAGGCCCAGGAACGTAGTGGGGCTGT
CCCTGCTCAACACGGCGAGGAACCCTCTCCAACTTTGGAGAGTTCCGCGT
GGGGCATCGTTCCTGAAACTGTTAAACCACAAGCACAGCCGCAAGTTACC
GAGCAGCCAAAAGTTTCAATTCCCAAGTCGACGCCTTCGACAAAGACTTC
CCCTCGCCCCACGCAAGCTCCAACTACATCTAGTAACGAGTGGCAAAACT
CCGAACCCGCTCCCCTTGTTCAACCTTTCCCTCCCCCAGTCAGTTCTCAA
TCTACTGTCCTCAACGTTGGCTCTAGCTCTATGGCTCGTAGCCCCTCAAA
TGAGAATCCTCACCCAAGTACCAGTGCTTCTGTCGCTCCTTGGGCGAACA
AGGATAACGAATTGAAGCAACCCTCTCTCACTCTCAAGGAGATCCAGGAA
ATTGAGGCAGAGCAACAACGCAACAAGGAGGCCCACGAAGCAGAACAGAG
GCGTCAGCTCATGGCCCAACAAGTGGCTAATCAGCCTCCTCCCCCGGCTC
CAGGCCTCCCGTCGACAGCCACCTGGGCAACATCTCCATCCGCTACTCCG
GCTACTGGATCTGCATCAGCTTGGGCTAAGCCATTGGTCAAGGCGAACTC
CCTTCCGAGTGCAGGTGCTAAAAAGACGCTTTCACAAATTCAAAGGGAAG
AAGAAGCCCGCAAAGCAAAGACTGCAGCACTCGCGGCGTCCACAGCCCAG
GCGGCAGCGCAGATCCCCTCCGCTCCTCTTGCTAGTGGAAAGAGGTACGC
TGATCTCGCTAGTAAGACCTCTCAGCCCATGGTTGGTGGAGCATGGACTA
CCGTCGGACCCGGAGGTAAATCCAAGCTGGGTGCCGGTGGTCCCACTGGC
CCTCTTCCTTCTACACCGACCGCGCCGGCCCAACCGTTAAGAACTGTGTC
TAGCACCATTGGTATACAAACTGCCAAAAAGGTAGTCCCGGCTGTTGTAC
CAGTCAAACCTGCCGCTACAAGCGCTGAGGGAGAATTCCACAAATGGGCA
ATGGCATCTCTTACTGGATTGAAAGACGGGGTCAAAGCCAATGAACTCCT
TGCTGAGATGCTTAACTTCCCCTTGGACGCCAGCCTCATCGCTGATACCA
TCTATGACTGTTCCACAACCATGGACGGCCGTCGCTTCGCTGCAGAATTT
ATCCGTCGGAAGGAGGCTGCCAGAATCGGTGTTGTCATTGAGGCAGGATC
ATCTAATGGCGGTGGAGCCAGTGGATGGAATGAGGTTGCGAAGGGAAAGG
CCAATACCCAACAAACTGCTAGGGATGCTAGCCCCGAGACTAATACTGCT
TTCAAGGTGGTTTCAGGGAAAAAGAAGGGGAGGAGATAGATGTATGGATA
TGTGTCGAGTTTTAAATCAAATAGCGGAGTCCATCGTCTGTAGCATGGCT
CGCAAGCTTGTGTACCGTAGCATAGTTAGGCAAATGGGAGTTTTTTTGTT
TTAAGGG

Sequences in the Contig:

SY0AAA12YE12FM1 SY0AAA30YL19FM1 SY0AAA42YN23FM1
SY0AAB35YM05FM1 SY0AAB39YN15FM1 SY0AAB48YJ05FM1
SY0AAC14YH12FM1 SY0AAC1YB08FM1 SY0AAC29YK13FM1
SY0AAC29YL24FM1 SY0AAC30YD02FM1 SY0AAC45YA03FM1
SY0AAC48YE01FM1 SY0AAC52YP15FM1 SY0AAC62YM21FM1
SY0AAD11YD11FM1 SY0AAD1YG22FM1 SY0AAD43YB21FM1
SY0AAD60YH16FM1