Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4293
Length(NT) : 686
Best Gene Model Blast : Link to GSTUMT00000908001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001212976.1| Score: 271 E_value: 2e-22
KEGG Definition: ankyrin repeat
Accession: aor:AO090103000097 Score: 262 E_value: 1e-21
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4293
TTGGCTACTAATTTCCCTAACCATAGATGCTATCCTTCGGGAAACCACAA
CATATGCTAGGCGGAAAAAGCTCAGGGCACTGACGCATGGCTTGGATTTA
AACGATGTTTATGGCGCGACTCTGGAACGGATACAAGAGCAGGGTGGAGA
GAAATCAAAGCTCGGGATGGCGGCACTGATGTGGATCTCTCATTCGGAGC
GGCTATTGCAACTCGATGAGCTCTTACACGCACTAGCAGTCGAGATAGGA
TCAACGGATCTGAATCCCGAAAACATTCCTTCGGTGGAGACCTTATTGAG
CTGTTGCTTCGGGCTTGTTGCCGTCGATAGGAAGACCTCGGCTTTTCGCT
TGATCCATTTCACTCTCCAGGAGTACCTCCAGACATGCCCCAACCTCTTT
GGTATGGCTCACGCGATAATGGCGGAAACCTGCCTTACATACCTCAACTT
TCGGACCATCAAAGAGATTTCACCTACAATCTTTGCTCTCCCTCGGTCAA
CTCCCTTTCTCAAATATTCAGCTTTATATTGGGGTGTCCATGCCAGGAGA
GCGGCTTCAAGGAACGTAGTATCGCTTGCGCTCATGCTCTTTGATCAAAT
TGAAACGCATATATCTACCAAGTTACTTTTGCTGGATATAGTGTCGAGGG
CTGGTCGATATAACCGTGACATCCCCACTAACGGCA

Sequences in the Contig:

SY0AAA1YM13FM1 SY0AAC29YK11FM1