Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4292
Length(NT) : 1434
Best Gene Model Blast : Link to GSTUMT00010549001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001544838.1| Score: 367 E_value: 2e-49
KEGG Definition: hypothetical protein
Accession: fgr:FG00970.1 Score: 379 E_value: 4e-49
KOG Definition:
Classification: [Energy production and conversion, Replication, recombination and repair].
Kog Number: KOG1970 Score: 134 E_value: 1e-08
PFAM Definition: Rad17, Rad17 cell cycle checkpoint protein..
Pfam Number: pfam03215 Score: 127 E_value: 8e-08

Sequence:
>Contig4292
TTGGCATCCTTTAGCAACGTCGATTACCTTCAATAAGATCGCTCCTACGT
TCATGATCAAGGCCCTATCGGCAATAATCACTCAAGAGTCACGCGAGTCC
AGTCGTAGATTTGGGCCTAGCAATCCAGTACTCCAAGCTTTATCCAGCAG
CGGAGACATCAGGAGTGCGATAATGGGCTTGGAGTTCTTGGCGGTAAATG
GGGAGGGAGGCGCATTTTCGGAGAAAGTGGATTTTAATGAGCGGGCGAAG
AGAAGGAAAGCATCGGGAGAAGGTGGCCTGAATGAGGTCGAACGAGAGAT
CTTGAATACTGACACAACGGGAATCAAGCCTGGGGCTCTTCCATGCAGTT
GGGAGAGTGGTATATAACAAACGGTATGGAGATGATCCCGGCGATCCATA
TATGCCTCCTCCACCGAAACCTCCTTTGCCCCATATTCCGTACAGGGCTA
GAGCTTCGCGAGTAGATCTCGACGGTCTGATGGACGAGGCAGGAACCGAC
CCTCAGACGTTCATCTCGGGGCTCCATGAAAACTACCTTGGTTCCTGTAA
TCATCTCGGTGGCCTTTCTCGCATTGACTATTCCATGGAAGATTCCCTCA
CCTGTGCAATTAACTGTATCGAAGGCCTCAGCGACAGTGATCTCTTGGCT
TCCCCAAAACCCTACCACCGAATCCTCGGCCGACTCGGCGGATACGAAGG
AGGCGACGTGGCAGTAGGATCAGCTGGGATCCGCCAGGATGAAATCTCTT
TCCAAACAGCCGTGCGGGGGGTCCTCCTCGGCCTGCCAACACCGGTGAGG
CGCGAAAACCGAGATACGAAAATGTACTACCCCACCGCCCTCCGCCTCTG
GAGAGACCAAGAGGAAGTCGAAGGCCTAATAGACCTCTTCGCCAAGCGCT
CCCAGACCGGCGGCGATTATGGTGACATTGGTGGCGACGGTACCATGGGA
ACCGATCGCGCGGAGTTGGCGATGGAACGGATGCCTTACTCCAAGATAAT
ACTGAAGGCCCGCCAACAGCGGAAAGCCACCACTGGGCCCTTCAACAGGA
GGGTCTTTGAAATGTCTGGCAAATTAACTGGCATAGGCGTGCTCAAGGAG
CTGGAGCAGGCCACAAACCTTAAGGGTGTAGCCGCCCGCCGTAGTGAGGA
CGTCCCCTGCCACGACGACCACGATGGGATGGCACAGGGAGCATCATCAG
ACGAACTGGAAGCAGCAGACGAGCGCAACAGACTACACTCGCGAAGGTAT
AATACCGCGCGGAATTACAAGAAGAGCGGCAGGTCTAAAGACCTAGACGC
TACCGTGCGCGTGGAAAGGCTGGTCCTTAGCGATGATGATATAGAAGATG
ATTGGTAGGGGAAAAAAAATCTCATTGGAATTGATTGAACTATTGTATTG
TAGAGTTGCGCTGGGTCTGGGCTGTTTCTAGGTA

Sequences in the Contig:

SY0AAA43YP10FM1 SY0AAC29YK03FM1 SY0AAC37YO17FM1
SY0AAD28YM16FM1