Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig429
Length(NT) : 767
Best Gene Model Blast : Link to GSTUMT00008556001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: NifU-related protein
Accession: ref|XP_001269693.1| Score: 614 E_value: 5e-62
KEGG Definition: NifU-related protein
Accession: afm:AFUA_1G04680 Score: 608 E_value: 1e-61
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2358 Score: 467 E_value: 1e-47
PFAM Definition: Nfu_N, Scaffold protein Nfu/NifU N terminal. This domain is found at the N terminus of NifU and NifU related proteins, and in the human Nfu protein. Both of these proteins are thought to be involved in the the assembly of iron-sulphur clusters..
Pfam Number: pfam08712 Score: 345 E_value: 2e-33
Swissprot: Q9UUB8|YH9J_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig429
TTGGCACTTCTTCGCCCCAGAAAAACCAGGTTCACCACAACCACCGCTTA
CCACCTCTGAAACAAATAAATAGATAGACAAACGGCCATGTCTTCGCGAA
TGCTTCTCACAAGACTATTCCTCCGACCCCGACCTCACTTTGTCCTCTTG
CCCGTGCGCCAATTTCACGCTCTCTACCGCCCCACCGTCCCACGCACATC
CCATATCCTCCGAAACCCCAAGCGCACACTCTTCATCCAAACCGAGTCGA
CGCCCAACCCATCCGCGCTAAAATTCATTCCTGGCCTCCCGGTCCTACCG
GAGGGTTGCCAGTCACAGGAGTACATTGACGGCCGCGAGACCCACAACTC
CCCGCTTGCTCGGAAGCTGTTTGCCGTCGATGGAGTTCGTAGTGTGTTCT
ATGGCCCGGACTTTATCACCATTACCAAGGATGAGGAGACCCAGTGGGCT
TTTCTGAAGGCGGAGGTTTATAGCCTTATCACTGAGGCGTTGAATAGCGG
GGAGCCGGTTATACTTGAGGGCACTATGGAGAGCAGCGATACTCAGAGGG
AGGAGGGAGATTCGGAGGTGGTTGGGATGATCAAGGAGTTGTTGGAGACG
AGGATTCGGCCGGCTATTCAAGAAGATGGTGGAGACATCGAATACCGCGG
CTTCGAGAACGGCGTTGTTAAGTTGAAACTCAGAGGCGCCTGCAGAACAT
GCGACTCTTCGACGGTAACACTGAAGAACGGAATTGAATCTATGCTTATG
CACTATGTACCCCCCCC

Sequences in the Contig:

SY0AAA23YO11FM1 SY0AAB10YB18FM1 SY0AAB26YD10FM1
SY0AAB58YM19FM1 SY0AAC21YJ11FM1 SY0AAC31YB11FM1
SY0AAD31YD14FM1 SY0AAD32YO02FM1 SY0AAD55YC05FM1
SY0AAD58YL23FM1